Incidental Mutation 'R3702:Zfp326'
ID258556
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Namezinc finger protein 326
Synonyms5730470H14Rik, ZAN75
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105876565-105915818 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 105888843 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440] [ENSMUST00000150440] [ENSMUST00000150440] [ENSMUST00000150440]
Predicted Effect probably null
Transcript: ENSMUST00000031227
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000031227
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150109
Predicted Effect probably null
Transcript: ENSMUST00000150440
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150440
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150440
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150440
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 105907045 missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 105896533 missense probably damaging 0.98
IGL01551:Zfp326 APN 5 105888585 missense probably damaging 1.00
IGL03197:Zfp326 APN 5 105891193 missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 105914690 missense probably benign 0.02
R0326:Zfp326 UTSW 5 105910275 missense probably damaging 1.00
R0411:Zfp326 UTSW 5 105878775 missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 105886203 nonsense probably null
R0850:Zfp326 UTSW 5 105878797 splice site probably null
R1833:Zfp326 UTSW 5 105891169 nonsense probably null
R2108:Zfp326 UTSW 5 105914780 utr 3 prime probably benign
R2857:Zfp326 UTSW 5 105888529 missense probably benign 0.11
R4690:Zfp326 UTSW 5 105907076 missense probably damaging 1.00
R5614:Zfp326 UTSW 5 105888495 missense probably damaging 1.00
R6212:Zfp326 UTSW 5 105910231 missense probably damaging 1.00
R6262:Zfp326 UTSW 5 105888487 missense probably damaging 1.00
R6274:Zfp326 UTSW 5 105905980 missense probably damaging 1.00
R6439:Zfp326 UTSW 5 105888718 missense probably null 0.69
R6963:Zfp326 UTSW 5 105911493 nonsense probably null
R8073:Zfp326 UTSW 5 105914816 missense unknown
Z1088:Zfp326 UTSW 5 105888630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAATTGAGGCCTGGGTTTATG -3'
(R):5'- TCCATGAATAATCATCTCACACTGC -3'

Sequencing Primer
(F):5'- CCTGGGTTTATGGAGGACAGAG -3'
(R):5'- CTCACACTGCAACTTATTTTCTAAGG -3'
Posted On2015-01-23