Incidental Mutation 'R3702:Zbed5'
ID258557
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Namezinc finger, BED type containing 5
Synonyms2410018M08Rik
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129895723-129903623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129903159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 650 (D650N)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041466
AA Change: D650N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: D650N

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129902133 unclassified probably null
IGL03334:Zbed5 APN 5 129902355 missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129901726 missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129902272 missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129902179 missense probably benign 0.00
R1967:Zbed5 UTSW 5 129901669 missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129902751 missense probably benign 0.01
R2925:Zbed5 UTSW 5 129903198 missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129902146 missense possibly damaging 0.66
R3701:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3916:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R3917:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R4547:Zbed5 UTSW 5 129902851 nonsense probably null
R4548:Zbed5 UTSW 5 129902851 nonsense probably null
R5195:Zbed5 UTSW 5 129902178 missense probably benign 0.01
R5500:Zbed5 UTSW 5 129901982 nonsense probably null
R5813:Zbed5 UTSW 5 129902218 missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129903369 missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129903289 missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129903185 missense probably benign
R6931:Zbed5 UTSW 5 129903329 nonsense probably null
R7223:Zbed5 UTSW 5 129900438 missense probably damaging 1.00
R7831:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
R7914:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCGCCTTCTTTGAGGAAC -3'
(R):5'- ACTACACTGCTACATTTCGGG -3'

Sequencing Primer
(F):5'- GCCTTCTTTGAGGAACATGAC -3'
(R):5'- TTCTCACCAGATCAGAAATTCTCGGG -3'
Posted On2015-01-23