Mutagenetix > Incidental Mutations

Incidental Mutation 'R3702:Sh2b2'

258559

Institutional Source

Beutler Lab

Gene Symbol

Sh2b2

Ensembl Gene

ENSMUSG00000005057

Gene Name

SH2B adaptor protein 2

Synonyms

Aps

MMRRC Submission

040695-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R3702 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136218147-136246556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136224233 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 362 (S362P)

Ref Sequence

ENSEMBL: ENSMUSP00000142728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196397] [ENSMUST00000196447]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005188
AA Change: S362P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: S362P

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
Pfam:Phe_ZIP	17	73	9.3e-22	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196397
AA Change: S362P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: S362P

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	1.5e-30	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000196447
AA Change: S362P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: S362P

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	9.1e-28	PFAM
Blast:PH	95	168	9e-22	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	2.2e-11	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197324

Meta Mutation Damage Score

0.4936

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,015,330	N55I	probably benign	Het
9530053A07Rik	G	A	7: 28,157,778	V2184M	probably damaging	Het
Abca5	C	T	11: 110,288,058		probably null	Het
Cacna1a	T	G	8: 84,617,846	S1846A	probably damaging	Het
Cacna1i	A	T	15: 80,381,071		probably benign	Het
Calhm3	T	A	19: 47,151,748	D302V	possibly damaging	Het
Cluh	A	G	11: 74,665,356	M878V	probably benign	Het
Col24a1	C	T	3: 145,337,860	H603Y	probably benign	Het
Commd1	T	A	11: 22,974,057	L277H	probably damaging	Het
Cpped1	G	T	16: 11,828,440	D135E	probably damaging	Het
Cul5	T	C	9: 53,629,216	K499E	probably damaging	Het
Elfn1	A	G	5: 139,972,359	T373A	probably benign	Het
Fam83h	C	T	15: 76,002,650	R946K	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Grik4	T	C	9: 42,675,218	K114E	probably damaging	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Itgb1bp2	T	C	X: 101,451,687		probably benign	Het
Lrp1	C	A	10: 127,595,103	R359L	probably damaging	Het
Lyn	A	G	4: 3,742,455	H28R	probably benign	Het
Mtmr10	T	C	7: 64,337,899	L729P	probably damaging	Het
Myot	T	A	18: 44,354,095		probably null	Het
Obox2	G	T	7: 15,396,957	R38L	probably benign	Het
Olfr787	A	T	10: 129,462,952	Y92F	probably damaging	Het
Pcdha3	A	G	18: 36,947,348	Q381R	probably benign	Het
Pip4k2b	A	G	11: 97,729,548		probably benign	Het
Ppig	T	A	2: 69,733,209	S89T	probably damaging	Het
Prune2	A	G	19: 17,178,871	D47G	probably damaging	Het
Snap91	G	A	9: 86,806,520	T322I	probably damaging	Het
Taf3	G	A	2: 9,952,561	T112I	possibly damaging	Het
Tcea1	T	C	1: 4,894,935	V276A	probably benign	Het
Tex15	T	C	8: 33,574,166	V1208A	probably benign	Het
Tomm40	G	T	7: 19,713,673	T144K	possibly damaging	Het
Zbed5	G	A	5: 129,903,159	D650N	possibly damaging	Het
Zfp326	A	G	5: 105,888,843		probably null	Het
Zfp647	G	A	15: 76,910,910	R517W	probably damaging	Het

Other mutations in Sh2b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sh2b2	APN	5	136224419	missense	probably damaging	1.00
IGL01456:Sh2b2	APN	5	136224467	missense	probably damaging	0.98
IGL01612:Sh2b2	APN	5	136231802	missense	probably benign	0.02
IGL02798:Sh2b2	APN	5	136221963	missense	probably damaging	1.00
R0492:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R0539:Sh2b2	UTSW	5	136225301	splice site	probably benign
R0707:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R1569:Sh2b2	UTSW	5	136231735	missense	possibly damaging	0.89
R1777:Sh2b2	UTSW	5	136227422	missense	probably damaging	1.00
R2088:Sh2b2	UTSW	5	136232114	missense	possibly damaging	0.87
R4223:Sh2b2	UTSW	5	136219053	missense	possibly damaging	0.91
R4597:Sh2b2	UTSW	5	136231762	missense	probably damaging	0.99
R4683:Sh2b2	UTSW	5	136231720	missense	probably damaging	1.00
R4766:Sh2b2	UTSW	5	136231957	missense	probably damaging	0.99
R5486:Sh2b2	UTSW	5	136232090	missense	probably benign	0.10
R6060:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R6322:Sh2b2	UTSW	5	136224188	missense	probably damaging	0.99
R7020:Sh2b2	UTSW	5	136224299	missense	possibly damaging	0.69
R7034:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7036:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7615:Sh2b2	UTSW	5	136219657	missense	probably damaging	1.00
R7715:Sh2b2	UTSW	5	136219035	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCCCGTTCTGGCTTAGAAAG -3'
(R):5'- CACAGGACTGTCTTGTGCAC -3'

Sequencing Primer
(F):5'- CTTAGAAAGCCAAAACCACTGTAG -3'
(R):5'- TGAGCTCCTGACAGATGGTAG -3'

Posted On

2015-01-23