Incidental Mutation 'R3702:Elfn1'
ID258560
Institutional Source Beutler Lab
Gene Symbol Elfn1
Ensembl Gene ENSMUSG00000048988
Gene Nameleucine rich repeat and fibronectin type III, extracellular 1
Synonyms
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139907943-139974722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139972359 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000053869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050519]
Predicted Effect probably benign
Transcript: ENSMUST00000050519
AA Change: T373A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053869
Gene: ENSMUSG00000048988
AA Change: T373A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 83 106 3.24e0 SMART
LRR 109 130 9.22e0 SMART
LRR 131 154 4.2e0 SMART
LRR 155 178 6.78e1 SMART
LRRCT 190 240 4.49e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
Blast:FN3 314 389 1e-27 BLAST
low complexity region 400 413 N/A INTRINSIC
transmembrane domain 418 440 N/A INTRINSIC
low complexity region 441 463 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198608
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous mutants display impaired coordination, hyperactivity, lower anxiety-related response, and increased susceptibility to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Elfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1969:Elfn1 UTSW 5 139972849 missense probably damaging 1.00
R2010:Elfn1 UTSW 5 139973316 missense probably damaging 1.00
R3898:Elfn1 UTSW 5 139971964 missense probably damaging 1.00
R3900:Elfn1 UTSW 5 139971964 missense probably damaging 1.00
R4284:Elfn1 UTSW 5 139972314 nonsense probably null
R4416:Elfn1 UTSW 5 139972194 missense possibly damaging 0.52
R4575:Elfn1 UTSW 5 139972053 missense probably benign
R4576:Elfn1 UTSW 5 139972053 missense probably benign
R4578:Elfn1 UTSW 5 139972053 missense probably benign
R4617:Elfn1 UTSW 5 139972009 missense probably damaging 0.99
R4729:Elfn1 UTSW 5 139973658 missense probably damaging 1.00
R4857:Elfn1 UTSW 5 139973085 missense probably damaging 1.00
R5431:Elfn1 UTSW 5 139971568 missense probably damaging 0.99
R5456:Elfn1 UTSW 5 139972816 missense probably damaging 1.00
R6463:Elfn1 UTSW 5 139972285 missense probably damaging 1.00
R6841:Elfn1 UTSW 5 139973145 missense probably damaging 1.00
R6925:Elfn1 UTSW 5 139971685 missense probably benign 0.02
R7224:Elfn1 UTSW 5 139972473 missense probably benign 0.00
R7465:Elfn1 UTSW 5 139972087 missense probably benign 0.34
V7732:Elfn1 UTSW 5 139971439 missense probably damaging 1.00
Z1177:Elfn1 UTSW 5 139972308 missense not run
Predicted Primers PCR Primer
(F):5'- TGATCCTGACTACGCTGGTC -3'
(R):5'- AGGCAGTAATAGACAGCGCC -3'

Sequencing Primer
(F):5'- TGACTACGCTGGTCCCTCAG -3'
(R):5'- GTAATAGACAGCGCCCAGAAC -3'
Posted On2015-01-23