Incidental Mutation 'R3702:Tomm40'
ID258561
Institutional Source Beutler Lab
Gene Symbol Tomm40
Ensembl Gene ENSMUSG00000002984
Gene Nametranslocase of outer mitochondrial membrane 40
SynonymsTom40
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19701313-19715438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19713673 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 144 (T144K)
Ref Sequence ENSEMBL: ENSMUSP00000104090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032555] [ENSMUST00000075447] [ENSMUST00000093552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032555
AA Change: T144K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984
AA Change: T144K

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075447
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093552
AA Change: T144K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984
AA Change: T144K

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Meta Mutation Damage Score 0.1281 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Tomm40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tomm40 APN 7 19703363 missense probably benign 0.13
IGL01766:Tomm40 APN 7 19703082 missense possibly damaging 0.93
IGL02831:Tomm40 APN 7 19703089 missense probably damaging 1.00
IGL03178:Tomm40 APN 7 19701834 missense probably damaging 0.98
PIT4131001:Tomm40 UTSW 7 19703091 missense probably damaging 1.00
R0280:Tomm40 UTSW 7 19713751 missense probably damaging 1.00
R1842:Tomm40 UTSW 7 19713725 missense probably benign 0.41
R1913:Tomm40 UTSW 7 19710961 missense probably damaging 0.98
R4685:Tomm40 UTSW 7 19701836 missense probably benign 0.06
R5165:Tomm40 UTSW 7 19713667 critical splice donor site probably null
R5380:Tomm40 UTSW 7 19701750 missense probably benign 0.27
R6026:Tomm40 UTSW 7 19710964 missense probably benign 0.43
R6236:Tomm40 UTSW 7 19703356 missense probably benign 0.15
R6994:Tomm40 UTSW 7 19702906 missense probably damaging 0.98
R7206:Tomm40 UTSW 7 19710936 missense probably benign 0.10
R7530:Tomm40 UTSW 7 19702904 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGTCATCACTAAGTTGTCCCC -3'
(R):5'- TGGATCCCTGGGCATTGATG -3'

Sequencing Primer
(F):5'- TCACCCCCAGGATGAGATAAAG -3'
(R):5'- TGCTAGTCGTGGCCTGACAC -3'
Posted On2015-01-23