Incidental Mutation 'R3702:Mtmr10'
ID258564
Institutional Source Beutler Lab
Gene Symbol Mtmr10
Ensembl Gene ENSMUSG00000030522
Gene Namemyotubularin related protein 10
Synonyms
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64287653-64340806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64337899 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 729 (L729P)
Ref Sequence ENSEMBL: ENSMUSP00000032736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032736] [ENSMUST00000206452]
Predicted Effect probably damaging
Transcript: ENSMUST00000032736
AA Change: L729P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032736
Gene: ENSMUSG00000030522
AA Change: L729P

DomainStartEndE-ValueType
Pfam:Myotub-related 176 330 8.6e-12 PFAM
Pfam:Myotub-related 319 508 2.7e-56 PFAM
Pfam:3-PAP 570 701 2.2e-57 PFAM
low complexity region 730 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173374
Predicted Effect probably benign
Transcript: ENSMUST00000206452
Meta Mutation Damage Score 0.1672 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Mtmr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Mtmr10 APN 7 64337712 missense probably benign
IGL02082:Mtmr10 APN 7 64333490 splice site probably benign
IGL02234:Mtmr10 APN 7 64299602 missense probably benign 0.04
IGL02448:Mtmr10 APN 7 64308150 missense probably damaging 1.00
IGL02515:Mtmr10 APN 7 64337511 missense probably damaging 1.00
Curlyq UTSW 7 64333439 missense probably damaging 1.00
K7371:Mtmr10 UTSW 7 64314210 missense probably benign 0.18
PIT4472001:Mtmr10 UTSW 7 64333358 missense probably benign 0.23
R0302:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R0619:Mtmr10 UTSW 7 64321213 missense probably benign 0.00
R0787:Mtmr10 UTSW 7 64300615 missense possibly damaging 0.95
R0972:Mtmr10 UTSW 7 64326709 missense probably damaging 1.00
R1482:Mtmr10 UTSW 7 64314249 missense probably damaging 1.00
R1770:Mtmr10 UTSW 7 64336721 missense possibly damaging 0.47
R1826:Mtmr10 UTSW 7 64337466 missense probably benign 0.00
R2174:Mtmr10 UTSW 7 64336764 missense possibly damaging 0.94
R2215:Mtmr10 UTSW 7 64337655 missense probably benign 0.00
R2352:Mtmr10 UTSW 7 64297580 missense possibly damaging 0.71
R2411:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R3710:Mtmr10 UTSW 7 64326685 missense possibly damaging 0.86
R3802:Mtmr10 UTSW 7 64320628 missense probably benign 0.29
R4190:Mtmr10 UTSW 7 64314186 missense probably benign 0.37
R4484:Mtmr10 UTSW 7 64320631 missense possibly damaging 0.86
R4562:Mtmr10 UTSW 7 64314159 missense possibly damaging 0.92
R5128:Mtmr10 UTSW 7 64333439 missense probably damaging 1.00
R5203:Mtmr10 UTSW 7 64318161 missense probably benign
R5444:Mtmr10 UTSW 7 64288401 unclassified probably null
R5627:Mtmr10 UTSW 7 64336752 missense probably damaging 1.00
R5786:Mtmr10 UTSW 7 64337710 missense probably damaging 1.00
R7078:Mtmr10 UTSW 7 64320627 missense possibly damaging 0.65
R7236:Mtmr10 UTSW 7 64314184 utr 3 prime probably benign
R7575:Mtmr10 UTSW 7 64297465 missense probably damaging 0.99
R7863:Mtmr10 UTSW 7 64319457 missense probably benign 0.03
R7946:Mtmr10 UTSW 7 64319457 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAAACTGTGCTACTTCCGTTG -3'
(R):5'- AATGTCCAGCTTCTCTCAATATGTC -3'

Sequencing Primer
(F):5'- ACTTCCGTTGGGTCCCTGAG -3'
(R):5'- TGCTTAATGGCGTTCCTA -3'
Posted On2015-01-23