Incidental Mutation 'R3702:Gm10608'
ID258571
Institutional Source Beutler Lab
Gene Symbol Gm10608
Ensembl Gene ENSMUSG00000074029
Gene Namepredicted gene 10608
SynonymsEG546165
MMRRC Submission 040695-MU
Accession Numbers

Genbank: XR_031269; Ensembl: ENSMUST00000093527; MGI: 3642009

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3702 (G1)
Quality Score150
Status Validated
Chromosome9
Chromosomal Location119162652-119164087 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA at 119160716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213924
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Gm10608
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Gm10608 UTSW 9 119161088 unclassified probably benign
R1023:Gm10608 UTSW 9 119160716 small deletion probably benign
R1053:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1167:Gm10608 UTSW 9 119160716 frame shift probably null
R1172:Gm10608 UTSW 9 119160716 frame shift probably null
R1211:Gm10608 UTSW 9 119160712 frame shift probably null
R1601:Gm10608 UTSW 9 119160716 frame shift probably null
R1743:Gm10608 UTSW 9 119160716 small deletion probably benign
R1766:Gm10608 UTSW 9 119160716 frame shift probably null
R1939:Gm10608 UTSW 9 119160716 frame shift probably null
R2016:Gm10608 UTSW 9 119160716 small deletion probably benign
R2127:Gm10608 UTSW 9 119160716 small deletion probably benign
R2217:Gm10608 UTSW 9 119160716 frame shift probably null
R2270:Gm10608 UTSW 9 119160716 frame shift probably null
R2372:Gm10608 UTSW 9 119160716 small deletion probably benign
R2844:Gm10608 UTSW 9 119160716 frame shift probably null
R2959:Gm10608 UTSW 9 119160716 frame shift probably null
R2968:Gm10608 UTSW 9 119160716 small deletion probably benign
R3084:Gm10608 UTSW 9 119160716 frame shift probably null
R3607:Gm10608 UTSW 9 119160716 small deletion probably benign
R3779:Gm10608 UTSW 9 119160716 small deletion probably benign
R3839:Gm10608 UTSW 9 119160716 frame shift probably null
R3900:Gm10608 UTSW 9 119160716 frame shift probably null
R3947:Gm10608 UTSW 9 119160662 small deletion probably benign
R4015:Gm10608 UTSW 9 119160716 frame shift probably null
R4024:Gm10608 UTSW 9 119160716 small deletion probably benign
R5346:Gm10608 UTSW 9 119160724 frame shift probably null
X0065:Gm10608 UTSW 9 119160863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGACAGGTGCCACAAC -3'
(R):5'- GCCTCTTCATAGGTCACATGCC -3'

Sequencing Primer
(F):5'- AGGTGCCACAACAGGGC -3'
(R):5'- TCAGATGGCAAAGCTTCCTG -3'
Posted On2015-01-23