Incidental Mutation 'R3702:Olfr787'
ID258573
Institutional Source Beutler Lab
Gene Symbol Olfr787
Ensembl Gene ENSMUSG00000096497
Gene Nameolfactory receptor 787
SynonymsMOR111-10, GA_x6K02T2PULF-11141498-11142436
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129461862-129467485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129462952 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 92 (Y92F)
Ref Sequence ENSEMBL: ENSMUSP00000149391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077836] [ENSMUST00000213329]
Predicted Effect probably damaging
Transcript: ENSMUST00000077836
AA Change: Y92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077005
Gene: ENSMUSG00000096497
AA Change: Y92F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4e-49 PFAM
Pfam:7tm_1 39 288 2.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213329
AA Change: Y92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Olfr787
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0384:Olfr787 UTSW 10 129463040 nonsense probably null
R1851:Olfr787 UTSW 10 129463501 missense probably damaging 1.00
R2211:Olfr787 UTSW 10 129462940 missense probably damaging 1.00
R3613:Olfr787 UTSW 10 129463068 missense probably benign 0.29
R3701:Olfr787 UTSW 10 129462952 missense probably damaging 1.00
R4496:Olfr787 UTSW 10 129463561 missense possibly damaging 0.93
R5745:Olfr787 UTSW 10 129463438 missense probably damaging 1.00
R6791:Olfr787 UTSW 10 129463154 missense probably benign 0.00
R7190:Olfr787 UTSW 10 129462757 missense probably benign 0.00
R7278:Olfr787 UTSW 10 129462751 missense probably damaging 1.00
R7313:Olfr787 UTSW 10 129462987 missense probably damaging 0.98
R7369:Olfr787 UTSW 10 129463521 missense probably benign
R7824:Olfr787 UTSW 10 129462796 missense probably damaging 1.00
R7851:Olfr787 UTSW 10 129463560 missense probably benign 0.36
R7934:Olfr787 UTSW 10 129463560 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGTGTCACTGGAAACCTAACC -3'
(R):5'- AAGCACAGAAGTCCAGCTTG -3'

Sequencing Primer
(F):5'- GTGTCACTGGAAACCTAACCATCATC -3'
(R):5'- TCCAGCTTGAGGACCAACATTAATG -3'
Posted On2015-01-23