Incidental Mutation 'R3702:Commd1'
ID258575
Institutional Source Beutler Lab
Gene Symbol Commd1
Ensembl Gene ENSMUSG00000051355
Gene NameCOMM domain containing 1
SynonymsMurr1
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location22896136-22982382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22974057 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 277 (L277H)
Ref Sequence ENSEMBL: ENSMUSP00000062025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049506] [ENSMUST00000057843] [ENSMUST00000071068] [ENSMUST00000159081] [ENSMUST00000160826]
Predicted Effect probably damaging
Transcript: ENSMUST00000049506
AA Change: L277H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062025
Gene: ENSMUSG00000044068
AA Change: L277H

DomainStartEndE-ValueType
low complexity region 14 39 N/A INTRINSIC
coiled coil region 52 144 N/A INTRINSIC
ZnF_C3H1 158 184 1.69e-3 SMART
RRM 190 291 1.44e-2 SMART
ZnF_C3H1 297 323 1.2e-3 SMART
low complexity region 364 389 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000057843
AA Change: E62V
SMART Domains Protein: ENSMUSP00000053606
Gene: ENSMUSG00000051355
AA Change: E62V

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:HCaRG 44 238 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071068
SMART Domains Protein: ENSMUSP00000065079
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:HCaRG 57 89 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093270
SMART Domains Protein: ENSMUSP00000090958
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 3 137 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159081
SMART Domains Protein: ENSMUSP00000124719
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 12 184 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160826
SMART Domains Protein: ENSMUSP00000125609
Gene: ENSMUSG00000098650

DomainStartEndE-ValueType
Pfam:HCaRG 1 99 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230879
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COMMD1 is a regulator of copper homeostasis, sodium uptake, and NF-kappa-B (see MIM 164011) signaling (de Bie et al., 2005 [PubMed 16267171]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal with growth retardation, failure to turn, increased apoptosis in brain mesenchyme and defects in extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Commd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Commd1 APN 11 22899981 missense probably damaging 1.00
IGL02275:Commd1 APN 11 22900017 missense probably damaging 1.00
R3763:Commd1 UTSW 11 22974102 missense probably benign 0.14
R7853:Commd1 UTSW 11 22956532 missense possibly damaging 0.61
R7936:Commd1 UTSW 11 22956532 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGGAGACCTACCAGCAGTTC -3'
(R):5'- CCAGAGTGGTAGCTTCTTGAC -3'

Sequencing Primer
(F):5'- AGCAGTTCTTGGATTTCTACCATGAC -3'
(R):5'- AGTTTTTACCAGAGGAGCCAGTC -3'
Posted On2015-01-23