Mutagenetix > Incidental Mutations

Incidental Mutation 'R3702:2010111I01Rik'

258580

Institutional Source

Beutler Lab

Gene Symbol

2010111I01Rik

Ensembl Gene

ENSMUSG00000021458

Gene Name

RIKEN cDNA 2010111I01 gene

Synonyms

ApO, aminopeptidase O

MMRRC Submission

040695-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R3702 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62964893-63326096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63015330 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 55 (N55I)

Ref Sequence

ENSEMBL: ENSMUSP00000021911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]

Predicted Effect

probably benign
Transcript: ENSMUST00000021911
AA Change: N55I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: N55I

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	221	359	5.4e-11	PFAM
Pfam:Peptidase_M1	385	558	2.3e-15	PFAM
Pfam:Peptidase_MA_2	453	613	1.3e-12	PFAM
Leuk-A4-hydro_C	675	821	3.02e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091560
AA Change: N55I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: N55I

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	220	359	2.7e-11	PFAM
Pfam:Peptidase_M1	386	561	1.9e-15	PFAM
Leuk-A4-hydro_C	676	822	3.02e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220863

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222181

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,157,778	V2184M	probably damaging	Het
Abca5	C	T	11: 110,288,058		probably null	Het
Cacna1a	T	G	8: 84,617,846	S1846A	probably damaging	Het
Cacna1i	A	T	15: 80,381,071		probably benign	Het
Calhm3	T	A	19: 47,151,748	D302V	possibly damaging	Het
Cluh	A	G	11: 74,665,356	M878V	probably benign	Het
Col24a1	C	T	3: 145,337,860	H603Y	probably benign	Het
Commd1	T	A	11: 22,974,057	L277H	probably damaging	Het
Cpped1	G	T	16: 11,828,440	D135E	probably damaging	Het
Cul5	T	C	9: 53,629,216	K499E	probably damaging	Het
Elfn1	A	G	5: 139,972,359	T373A	probably benign	Het
Fam83h	C	T	15: 76,002,650	R946K	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Grik4	T	C	9: 42,675,218	K114E	probably damaging	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Itgb1bp2	T	C	X: 101,451,687		probably benign	Het
Lrp1	C	A	10: 127,595,103	R359L	probably damaging	Het
Lyn	A	G	4: 3,742,455	H28R	probably benign	Het
Mtmr10	T	C	7: 64,337,899	L729P	probably damaging	Het
Myot	T	A	18: 44,354,095		probably null	Het
Obox2	G	T	7: 15,396,957	R38L	probably benign	Het
Olfr787	A	T	10: 129,462,952	Y92F	probably damaging	Het
Pcdha3	A	G	18: 36,947,348	Q381R	probably benign	Het
Pip4k2b	A	G	11: 97,729,548		probably benign	Het
Ppig	T	A	2: 69,733,209	S89T	probably damaging	Het
Prune2	A	G	19: 17,178,871	D47G	probably damaging	Het
Sh2b2	A	G	5: 136,224,233	S362P	probably damaging	Het
Snap91	G	A	9: 86,806,520	T322I	probably damaging	Het
Taf3	G	A	2: 9,952,561	T112I	possibly damaging	Het
Tcea1	T	C	1: 4,894,935	V276A	probably benign	Het
Tex15	T	C	8: 33,574,166	V1208A	probably benign	Het
Tomm40	G	T	7: 19,713,673	T144K	possibly damaging	Het
Zbed5	G	A	5: 129,903,159	D650N	possibly damaging	Het
Zfp326	A	G	5: 105,888,843		probably null	Het
Zfp647	G	A	15: 76,910,910	R517W	probably damaging	Het

Other mutations in 2010111I01Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:2010111I01Rik	APN	13	63199500	splice site	probably benign
IGL00329:2010111I01Rik	APN	13	63191163	missense	probably damaging	1.00
IGL00336:2010111I01Rik	APN	13	63015423	missense	possibly damaging	0.78
IGL01384:2010111I01Rik	APN	13	63190476	splice site	probably benign
IGL01780:2010111I01Rik	APN	13	63210125	missense	probably benign	0.00
IGL01876:2010111I01Rik	APN	13	63190522	missense	probably damaging	1.00
IGL02096:2010111I01Rik	APN	13	63061089	missense	probably benign	0.04
IGL02166:2010111I01Rik	APN	13	63015453	missense	probably benign	0.02
IGL02184:2010111I01Rik	APN	13	63068111	missense	possibly damaging	0.50
PIT4378001:2010111I01Rik	UTSW	13	63015207	missense	probably damaging	1.00
R0139:2010111I01Rik	UTSW	13	63190484	missense	probably benign	0.01
R1209:2010111I01Rik	UTSW	13	63191064	unclassified	probably null
R1233:2010111I01Rik	UTSW	13	63199520	missense	probably damaging	0.96
R1756:2010111I01Rik	UTSW	13	63068061	missense	possibly damaging	0.95
R1786:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R1861:2010111I01Rik	UTSW	13	63015783	missense	probably damaging	1.00
R2130:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R2131:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R3076:2010111I01Rik	UTSW	13	63240115	missense	probably damaging	0.96
R3912:2010111I01Rik	UTSW	13	63156706	nonsense	probably null
R4512:2010111I01Rik	UTSW	13	63156667	missense	probably damaging	0.99
R4593:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4596:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4597:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4616:2010111I01Rik	UTSW	13	63298751	missense	probably damaging	1.00
R4625:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4627:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4630:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4632:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4911:2010111I01Rik	UTSW	13	63170939	critical splice acceptor site	probably null
R5204:2010111I01Rik	UTSW	13	63033090	missense	probably benign	0.15
R5210:2010111I01Rik	UTSW	13	63068110	missense	probably benign	0.00
R5849:2010111I01Rik	UTSW	13	63015498	missense	probably benign	0.00
R5861:2010111I01Rik	UTSW	13	63298812	missense	probably damaging	1.00
R5960:2010111I01Rik	UTSW	13	63240273	missense	probably damaging	0.99
R6021:2010111I01Rik	UTSW	13	63061082	missense	probably damaging	1.00
R6048:2010111I01Rik	UTSW	13	63240325	missense	probably damaging	0.99
R6379:2010111I01Rik	UTSW	13	63068243	missense	probably damaging	0.97
R7038:2010111I01Rik	UTSW	13	63190525	missense	possibly damaging	0.54
R7493:2010111I01Rik	UTSW	13	63015531	missense	probably benign	0.01
R7788:2010111I01Rik	UTSW	13	63156593	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACACCATGGACATAAAGCTGG -3'
(R):5'- GATTCCCTGTGTCACAGCAG -3'

Sequencing Primer
(F):5'- TGGACATAAAGCTGGACCCTTC -3'
(R):5'- GAGATCTCAGAATCACGTTCCTGG -3'

Posted On

2015-01-23