Incidental Mutation 'R3702:Fam83h'
ID258581
Institutional Source Beutler Lab
Gene Symbol Fam83h
Ensembl Gene ENSMUSG00000046761
Gene Namefamily with sequence similarity 83, member H
Synonyms
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76001093-76014336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76002650 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 946 (R946K)
Ref Sequence ENSEMBL: ENSMUSP00000126453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060807] [ENSMUST00000089669] [ENSMUST00000170153]
Predicted Effect probably benign
Transcript: ENSMUST00000060807
AA Change: R946K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059839
Gene: ENSMUSG00000046761
AA Change: R946K

DomainStartEndE-ValueType
Pfam:DUF1669 12 283 3.4e-105 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000089669
SMART Domains Protein: ENSMUSP00000087098
Gene: ENSMUSG00000063704

DomainStartEndE-ValueType
S_TKc 14 305 7.08e-97 SMART
low complexity region 391 404 N/A INTRINSIC
low complexity region 424 434 N/A INTRINSIC
low complexity region 475 505 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 538 548 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160637
Predicted Effect probably benign
Transcript: ENSMUST00000170153
AA Change: R946K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126453
Gene: ENSMUSG00000046761
AA Change: R946K

DomainStartEndE-ValueType
Pfam:DUF1669 4 284 2.1e-110 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000230929
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the structural development and calcification of tooth enamel. Defects in this gene are a cause of amelogenesis imperfecta type 3 (AI3). [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Fam83h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Fam83h APN 15 76004036 missense probably damaging 0.98
IGL01463:Fam83h APN 15 76003788 missense possibly damaging 0.57
IGL01789:Fam83h APN 15 76006120 missense probably damaging 1.00
IGL02029:Fam83h APN 15 76006438 missense probably damaging 1.00
IGL02157:Fam83h APN 15 76005055 missense probably damaging 1.00
IGL03225:Fam83h APN 15 76003301 missense probably damaging 1.00
PIT4260001:Fam83h UTSW 15 76001897 missense probably damaging 1.00
R0008:Fam83h UTSW 15 76003962 missense probably damaging 1.00
R0071:Fam83h UTSW 15 76002528 missense probably benign
R0318:Fam83h UTSW 15 76003629 missense probably benign 0.04
R0539:Fam83h UTSW 15 76003227 missense possibly damaging 0.88
R0638:Fam83h UTSW 15 76003927 missense probably benign 0.01
R0790:Fam83h UTSW 15 76003392 missense probably benign 0.43
R0883:Fam83h UTSW 15 76006169 missense probably damaging 1.00
R1970:Fam83h UTSW 15 76006570 unclassified probably benign
R2046:Fam83h UTSW 15 76002938 missense probably benign
R2114:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2115:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2117:Fam83h UTSW 15 76004733 nonsense probably null
R3842:Fam83h UTSW 15 76002650 missense probably benign
R4729:Fam83h UTSW 15 76002336 missense probably benign
R4791:Fam83h UTSW 15 76002368 missense probably damaging 1.00
R5024:Fam83h UTSW 15 76005142 missense probably damaging 1.00
R5471:Fam83h UTSW 15 76002903 missense probably benign 0.00
R6013:Fam83h UTSW 15 76004000 missense probably damaging 0.99
R6488:Fam83h UTSW 15 76002053 missense possibly damaging 0.67
R6558:Fam83h UTSW 15 76004453 missense probably damaging 1.00
R6618:Fam83h UTSW 15 76003511 missense probably damaging 1.00
R7030:Fam83h UTSW 15 76004739 missense probably benign 0.08
R7148:Fam83h UTSW 15 76005167 missense probably damaging 0.98
R7191:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R7438:Fam83h UTSW 15 76004426 missense possibly damaging 0.93
R7705:Fam83h UTSW 15 76003850 missense probably damaging 0.99
X0010:Fam83h UTSW 15 76004939 critical splice donor site probably null
X0061:Fam83h UTSW 15 76003503 missense probably damaging 1.00
Z1177:Fam83h UTSW 15 76002962 missense probably benign 0.00
Z1177:Fam83h UTSW 15 76006541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCATTCTTGGGGCTCAG -3'
(R):5'- CCTTATTCTGAGCCAAAGGGAAAC -3'

Sequencing Primer
(F):5'- TCTTGGGGCTCAGCAGCTG -3'
(R):5'- AGCTTACCCTGAGCGCAAG -3'
Posted On2015-01-23