Mutagenetix > Incidental Mutations

Incidental Mutation 'R3702:Cacna1i'

258583

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

040695-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3702 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 80381071 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

Predicted Effect

probably benign
Transcript: ENSMUST00000160424

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162155

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,015,330	N55I	probably benign	Het
9530053A07Rik	G	A	7: 28,157,778	V2184M	probably damaging	Het
Abca5	C	T	11: 110,288,058		probably null	Het
Cacna1a	T	G	8: 84,617,846	S1846A	probably damaging	Het
Calhm3	T	A	19: 47,151,748	D302V	possibly damaging	Het
Cluh	A	G	11: 74,665,356	M878V	probably benign	Het
Col24a1	C	T	3: 145,337,860	H603Y	probably benign	Het
Commd1	T	A	11: 22,974,057	L277H	probably damaging	Het
Cpped1	G	T	16: 11,828,440	D135E	probably damaging	Het
Cul5	T	C	9: 53,629,216	K499E	probably damaging	Het
Elfn1	A	G	5: 139,972,359	T373A	probably benign	Het
Fam83h	C	T	15: 76,002,650	R946K	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Grik4	T	C	9: 42,675,218	K114E	probably damaging	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Itgb1bp2	T	C	X: 101,451,687		probably benign	Het
Lrp1	C	A	10: 127,595,103	R359L	probably damaging	Het
Lyn	A	G	4: 3,742,455	H28R	probably benign	Het
Mtmr10	T	C	7: 64,337,899	L729P	probably damaging	Het
Myot	T	A	18: 44,354,095		probably null	Het
Obox2	G	T	7: 15,396,957	R38L	probably benign	Het
Olfr787	A	T	10: 129,462,952	Y92F	probably damaging	Het
Pcdha3	A	G	18: 36,947,348	Q381R	probably benign	Het
Pip4k2b	A	G	11: 97,729,548		probably benign	Het
Ppig	T	A	2: 69,733,209	S89T	probably damaging	Het
Prune2	A	G	19: 17,178,871	D47G	probably damaging	Het
Sh2b2	A	G	5: 136,224,233	S362P	probably damaging	Het
Snap91	G	A	9: 86,806,520	T322I	probably damaging	Het
Taf3	G	A	2: 9,952,561	T112I	possibly damaging	Het
Tcea1	T	C	1: 4,894,935	V276A	probably benign	Het
Tex15	T	C	8: 33,574,166	V1208A	probably benign	Het
Tomm40	G	T	7: 19,713,673	T144K	possibly damaging	Het
Zbed5	G	A	5: 129,903,159	D650N	possibly damaging	Het
Zfp326	A	G	5: 105,888,843		probably null	Het
Zfp647	G	A	15: 76,910,910	R517W	probably damaging	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6463:Cacna1i	UTSW	15	80355758	missense	probably damaging	0.97
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7017:Cacna1i	UTSW	15	80380470	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7820:Cacna1i	UTSW	15	80372372	missense	probably benign	0.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8206:Cacna1i	UTSW	15	80389815	splice site	probably null
R8270:Cacna1i	UTSW	15	80373634	missense	probably damaging	0.99
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
R8696:Cacna1i	UTSW	15	80381974	missense	probably damaging	0.98
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GGAGGCCAGAGATGTTTCTTC -3'
(R):5'- TAGGTAACCAATGGGGAGCC -3'

Sequencing Primer
(F):5'- AGTGGGCCAAACTCACTGGTAC -3'
(R):5'- GGAGCCCCCTTCCCACC -3'

Posted On

2015-01-23