Incidental Mutation 'R3702:Cpped1'
ID258584
Institutional Source Beutler Lab
Gene Symbol Cpped1
Ensembl Gene ENSMUSG00000065979
Gene Namecalcineurin-like phosphoesterase domain containing 1
Synonyms
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11803721-11909445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11828440 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 135 (D135E)
Ref Sequence ENSEMBL: ENSMUSP00000112587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096272] [ENSMUST00000121750] [ENSMUST00000127972]
Predicted Effect probably damaging
Transcript: ENSMUST00000096272
AA Change: D149E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093992
Gene: ENSMUSG00000065979
AA Change: D149E

DomainStartEndE-ValueType
Pfam:Metallophos 33 250 4.6e-14 PFAM
Pfam:Metallophos_2 63 285 6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121750
AA Change: D135E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112587
Gene: ENSMUSG00000065979
AA Change: D135E

DomainStartEndE-ValueType
Pfam:Metallophos 25 236 1e-14 PFAM
Pfam:Metallophos_2 45 271 6.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127972
AA Change: D173E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119989
Gene: ENSMUSG00000065979
AA Change: D173E

DomainStartEndE-ValueType
Pfam:Metallophos 57 239 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145169
Meta Mutation Damage Score 0.7513 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Cpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Cpped1 APN 16 11828528 missense probably damaging 1.00
IGL02448:Cpped1 APN 16 11805389 missense probably benign 0.30
IGL03048:Cpped1 UTSW 16 11828475 missense probably benign 0.23
R0725:Cpped1 UTSW 16 11828450 missense probably damaging 0.97
R2084:Cpped1 UTSW 16 11828501 missense probably damaging 1.00
R2276:Cpped1 UTSW 16 11894881 critical splice donor site probably null
R4321:Cpped1 UTSW 16 11887746 missense probably benign 0.35
R4407:Cpped1 UTSW 16 11805421 missense probably damaging 0.96
R4421:Cpped1 UTSW 16 11805357 makesense probably null
R4672:Cpped1 UTSW 16 11805374 nonsense probably null
R4704:Cpped1 UTSW 16 11885629 intron probably benign
R4928:Cpped1 UTSW 16 11828279 missense probably damaging 1.00
R5647:Cpped1 UTSW 16 11828146 unclassified probably benign
R7260:Cpped1 UTSW 16 11828463 missense possibly damaging 0.90
R7610:Cpped1 UTSW 16 11894878 splice site probably null
R8008:Cpped1 UTSW 16 11828396 missense probably damaging 1.00
X0017:Cpped1 UTSW 16 11828292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAATACTCTGCAGGAATAGC -3'
(R):5'- TAGGTAAATGGCCTGCAGCG -3'

Sequencing Primer
(F):5'- TACTCTGCAGGAATAGCGGGATATG -3'
(R):5'- GCCTGCAGCGCTCTCATAATTC -3'
Posted On2015-01-23