Incidental Mutation 'R3703:Trdmt1'
ID258594
Institutional Source Beutler Lab
Gene Symbol Trdmt1
Ensembl Gene ENSMUSG00000026723
Gene NametRNA aspartic acid methyltransferase 1
SynonymsRnmt2, Dnmt2
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R3703 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location13509014-13544668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13521297 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 170 (Q170L)
Ref Sequence ENSEMBL: ENSMUSP00000114572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124488] [ENSMUST00000144957]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028055
Predicted Effect probably benign
Transcript: ENSMUST00000124488
AA Change: Q170L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114572
Gene: ENSMUSG00000026723
AA Change: Q170L

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 391 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144957
SMART Domains Protein: ENSMUSP00000141758
Gene: ENSMUSG00000026723

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 84 4.7e-13 PFAM
Meta Mutation Damage Score 0.0930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased proportion of natural killer cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mug1 C T 6: 121,888,556 probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rab1a T G 11: 20,224,506 probably benign Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Snx9 T A 17: 5,928,200 probably null Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tmprss15 T C 16: 79,054,142 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Trdmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Trdmt1 APN 2 13521260 splice site probably null
IGL01584:Trdmt1 APN 2 13519928 missense probably benign 0.00
IGL02491:Trdmt1 APN 2 13516672 missense probably benign 0.17
IGL03025:Trdmt1 APN 2 13523435 missense probably damaging 0.98
R0167:Trdmt1 UTSW 2 13516018 missense probably damaging 1.00
R0193:Trdmt1 UTSW 2 13544617 missense probably damaging 1.00
R0638:Trdmt1 UTSW 2 13516648 splice site probably benign
R0690:Trdmt1 UTSW 2 13544580 missense probably benign 0.01
R0735:Trdmt1 UTSW 2 13523438 missense probably benign 0.23
R1102:Trdmt1 UTSW 2 13523414 splice site probably benign
R1432:Trdmt1 UTSW 2 13519846 missense probably damaging 0.98
R1610:Trdmt1 UTSW 2 13516059 missense probably damaging 1.00
R1935:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R1936:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R2060:Trdmt1 UTSW 2 13519914 missense probably benign 0.01
R2231:Trdmt1 UTSW 2 13525625 missense probably damaging 1.00
R2339:Trdmt1 UTSW 2 13520060 nonsense probably null
R3735:Trdmt1 UTSW 2 13519873 missense possibly damaging 0.51
R4751:Trdmt1 UTSW 2 13544653 utr 5 prime probably benign
R6258:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6260:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6799:Trdmt1 UTSW 2 13516013 critical splice donor site probably null
R7329:Trdmt1 UTSW 2 13516122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGAGAAGCAGAGACCT -3'
(R):5'- AGTAGCCAAGAATAGCTATATTTGAGT -3'

Sequencing Primer
(F):5'- CCTGAAAATGGACACGAAGATGACC -3'
(R):5'- GAAGTCCCCCACATTTCA -3'
Posted On2015-01-23