Mutagenetix > Incidental Mutations

Incidental Mutation 'R3703:Col25a1'

258599

Institutional Source

Beutler Lab

Gene Symbol

Col25a1

Ensembl Gene

ENSMUSG00000058897

Gene Name

collagen, type XXV, alpha 1

Synonyms

2700062B08Rik

MMRRC Submission

040696-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R3703 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130131501-130599877 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 130550033 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000106353] [ENSMUST00000183368]

Predicted Effect

probably null
Transcript: ENSMUST00000080335

SMART Domains

Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:Collagen	119	165	7e-9	PFAM
low complexity region	188	246	N/A	INTRINSIC
low complexity region	275	288	N/A	INTRINSIC
Pfam:Collagen	311	374	5.4e-11	PFAM
Pfam:Collagen	368	427	2e-9	PFAM
Pfam:Collagen	447	504	1.6e-10	PFAM
Pfam:Collagen	494	561	3.3e-8	PFAM
Pfam:Collagen	586	660	4.3e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106353

SMART Domains

Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:Collagen	119	174	1.7e-11	PFAM
Pfam:Collagen	183	244	6.2e-12	PFAM
Pfam:Collagen	233	297	7.5e-11	PFAM
Pfam:Collagen	294	345	1.8e-9	PFAM
Pfam:Collagen	343	399	1.1e-10	PFAM
Pfam:Collagen	419	475	1.9e-10	PFAM
low complexity region	490	525	N/A	INTRINSIC
Pfam:Collagen	555	622	6e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106353

SMART Domains

Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:Collagen	119	174	1.7e-11	PFAM
Pfam:Collagen	183	244	6.2e-12	PFAM
Pfam:Collagen	233	297	7.5e-11	PFAM
Pfam:Collagen	294	345	1.8e-9	PFAM
Pfam:Collagen	343	399	1.1e-10	PFAM
Pfam:Collagen	419	475	1.9e-10	PFAM
low complexity region	490	525	N/A	INTRINSIC
Pfam:Collagen	555	622	6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143830

Predicted Effect

probably benign
Transcript: ENSMUST00000183368

SMART Domains

Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:Collagen	119	165	6.8e-9	PFAM
low complexity region	188	246	N/A	INTRINSIC
internal_repeat_2	249	294	2.8e-5	PROSPERO
internal_repeat_1	294	308	4.06e-8	PROSPERO
Pfam:Collagen	309	372	2.1e-11	PFAM
Pfam:Collagen	371	427	3.7e-10	PFAM
Pfam:Collagen	447	496	7.7e-10	PFAM
low complexity region	497	506	N/A	INTRINSIC
low complexity region	514	527	N/A	INTRINSIC
low complexity region	556	571	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196743

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,987,581	C2703S	probably damaging	Het
Arhgap10	C	T	8: 77,259,056		probably null	Het
Asap3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGAGGAGGA	4: 136,241,241		probably benign	Het
Bcap29	T	C	12: 31,617,152	H170R	probably benign	Het
Brf1	T	C	12: 112,969,371		probably null	Het
Btnl7-ps	T	A	17: 34,533,967		noncoding transcript	Het
Cdh12	C	A	15: 21,583,826	T584K	probably damaging	Het
Col13a1	A	G	10: 61,867,829		probably null	Het
Csrp2	G	A	10: 110,937,874		probably benign	Het
Ctla2a	T	A	13: 60,936,007	D37V	probably damaging	Het
Cubn	T	A	2: 13,350,943	H1826L	probably damaging	Het
Dnajc19	A	G	3: 34,080,229		probably null	Het
Dxo	T	C	17: 34,838,769		probably benign	Het
Edil3	A	T	13: 89,177,298	M269L	probably benign	Het
Fbxl7	C	A	15: 26,543,755	G269C	probably damaging	Het
Gpnmb	T	A	6: 49,051,865	I439N	possibly damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Gtpbp3	T	G	8: 71,492,135	S345A	probably benign	Het
Hnrnpul2	A	G	19: 8,824,409	E327G	probably damaging	Het
Ifi207	A	T	1: 173,727,463	Y884*	probably null	Het
Ifi47	T	C	11: 49,095,525	S40P	probably benign	Het
Kcnq3	A	G	15: 66,021,739		probably null	Het
Kifc3	G	A	8: 95,104,028		probably benign	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Mug1	C	T	6: 121,888,556		probably benign	Het
Myh2	A	G	11: 67,189,601	I1214V	probably benign	Het
Naa30	A	G	14: 49,187,602	N337S	probably benign	Het
Nap1l3	A	T	X: 122,395,524	I499N	possibly damaging	Het
Nfat5	T	A	8: 107,351,421		probably benign	Het
Nisch	A	G	14: 31,176,745		probably benign	Het
Nt5c3	A	G	6: 56,883,667		probably benign	Het
Pklr	C	T	3: 89,142,701	R328C	probably damaging	Het
Prrc2c	G	A	1: 162,710,691	R457C	probably damaging	Het
Rab1a	T	G	11: 20,224,506		probably benign	Het
Rasa3	A	T	8: 13,588,972	D278E	probably benign	Het
Rdh8	C	T	9: 20,823,333	P99S	probably damaging	Het
Snx9	T	A	17: 5,928,200		probably null	Het
Spns3	C	T	11: 72,499,530		probably benign	Het
Sympk	A	G	7: 19,040,561	Y421C	probably damaging	Het
Tas1r2	G	A	4: 139,667,418	C495Y	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Tmprss15	T	C	16: 79,054,142		probably null	Het
Tox3	G	T	8: 90,248,905	T366K	possibly damaging	Het
Trdmt1	T	A	2: 13,521,297	Q170L	probably benign	Het
Ttn	A	T	2: 76,735,408	V28200D	probably damaging	Het
Zfp616	G	A	11: 74,083,319	W138*	probably null	Het
Zfr2	T	G	10: 81,246,079	V493G	probably benign	Het

Other mutations in Col25a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Col25a1	APN	3	130181784	splice site	probably benign
IGL00570:Col25a1	APN	3	130546432	splice site	probably benign
IGL01651:Col25a1	APN	3	130566485	missense	probably benign	0.06
IGL02033:Col25a1	APN	3	130388948	splice site	probably benign
IGL02117:Col25a1	APN	3	130519773	splice site	probably benign
IGL02290:Col25a1	APN	3	130519811	splice site	probably benign
IGL03135:Col25a1	APN	3	130529683	splice site	probably benign
R0526:Col25a1	UTSW	3	130476394	missense	probably damaging	1.00
R0602:Col25a1	UTSW	3	130575414	splice site	probably null
R0670:Col25a1	UTSW	3	130386895	missense	possibly damaging	0.95
R0830:Col25a1	UTSW	3	130584726	missense	probably damaging	1.00
R1220:Col25a1	UTSW	3	130388925	splice site	probably benign
R1623:Col25a1	UTSW	3	130550050	missense	probably damaging	1.00
R1818:Col25a1	UTSW	3	130585737	critical splice donor site	probably null
R2142:Col25a1	UTSW	3	130570316	missense	probably damaging	1.00
R2190:Col25a1	UTSW	3	130584715	missense	probably damaging	1.00
R2901:Col25a1	UTSW	3	130546391	missense	probably damaging	1.00
R2902:Col25a1	UTSW	3	130546391	missense	probably damaging	1.00
R3818:Col25a1	UTSW	3	130550071	missense	possibly damaging	0.88
R4726:Col25a1	UTSW	3	130519781	missense	possibly damaging	0.92
R4775:Col25a1	UTSW	3	130182819	missense	possibly damaging	0.96
R5036:Col25a1	UTSW	3	130583329	splice site	probably null
R5110:Col25a1	UTSW	3	130584725	makesense	probably null
R5501:Col25a1	UTSW	3	130595663	missense	probably benign	0.07
R5686:Col25a1	UTSW	3	130564154	missense	probably damaging	1.00
R5698:Col25a1	UTSW	3	130478983	critical splice acceptor site	probably null
R6131:Col25a1	UTSW	3	130535465	missense	probably damaging	1.00
R6142:Col25a1	UTSW	3	130583329	splice site	probably benign
R6549:Col25a1	UTSW	3	130182795	missense	probably benign
R6624:Col25a1	UTSW	3	130566451	splice site	probably null
R6898:Col25a1	UTSW	3	130584728	critical splice donor site	probably null
R7030:Col25a1	UTSW	3	130479022	critical splice donor site	probably null
R7114:Col25a1	UTSW	3	130595675	missense	probably benign	0.06
R7172:Col25a1	UTSW	3	130570332	nonsense	probably null
R7179:Col25a1	UTSW	3	130530119	missense	probably damaging	0.99
R7340:Col25a1	UTSW	3	130546357	splice site	probably null
R7488:Col25a1	UTSW	3	130584701	missense	probably damaging	1.00
X0028:Col25a1	UTSW	3	130577318	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- ACTGTCCCCAAAGTCATAATGG -3'
(R):5'- TGTCTTGTGATACAATCATAGGGAC -3'

Sequencing Primer
(F):5'- TGTCCCCAAAGTCATAATGGATAGAG -3'
(R):5'- TGTGATACAATCATAGGGACAAACC -3'

Posted On

2015-01-23