Incidental Mutation 'R3703:Rab1a'
ID258617
Institutional Source Beutler Lab
Gene Symbol Rab1a
Ensembl Gene ENSMUSG00000020149
Gene NameRAB1A, member RAS oncogene family
SynonymsYpt1, Rab1, Rab-1, Gtbp, ras-related YPT1 protein
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R3703 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location20201432-20226856 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 20224506 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020358] [ENSMUST00000050611] [ENSMUST00000109601] [ENSMUST00000109602] [ENSMUST00000163483]
Predicted Effect probably benign
Transcript: ENSMUST00000020358
SMART Domains Protein: ENSMUSP00000020358
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
RAB 9 172 2.9e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050611
SMART Domains Protein: ENSMUSP00000054943
Gene: ENSMUSG00000044066

DomainStartEndE-ValueType
low complexity region 178 190 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
SPEC 605 706 1.28e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109601
SMART Domains Protein: ENSMUSP00000105230
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
Pfam:Ras 10 63 1.4e-18 PFAM
Pfam:Miro 10 93 8.4e-7 PFAM
Pfam:Ras 61 95 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109602
SMART Domains Protein: ENSMUSP00000105231
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
Pfam:Ras 10 31 7.6e-6 PFAM
Pfam:Ras 29 107 8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152728
Predicted Effect probably benign
Transcript: ENSMUST00000163483
SMART Domains Protein: ENSMUSP00000127330
Gene: ENSMUSG00000020149

DomainStartEndE-ValueType
RAB 12 175 2.9e-107 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mug1 C T 6: 121,888,556 probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Snx9 T A 17: 5,928,200 probably null Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tmprss15 T C 16: 79,054,142 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Trdmt1 T A 2: 13,521,297 Q170L probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Rab1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Rab1a APN 11 20224727 missense possibly damaging 0.92
IGL01639:Rab1a APN 11 20223185 splice site probably benign
IGL01982:Rab1a APN 11 20224717 missense probably benign 0.17
R0504:Rab1a UTSW 11 20223169 missense probably damaging 0.99
R1167:Rab1a UTSW 11 20223172 missense possibly damaging 0.93
R2967:Rab1a UTSW 11 20223068 intron probably null
R5623:Rab1a UTSW 11 20201626 utr 5 prime probably benign
R5897:Rab1a UTSW 11 20218867 nonsense probably null
R7864:Rab1a UTSW 11 20215673 nonsense probably null
R7947:Rab1a UTSW 11 20215673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTCCTTAGTTAGAGCAGCAGTG -3'
(R):5'- CGTTGCGTTCTTAGCACTGG -3'

Sequencing Primer
(F):5'- CTTAGTTAGAGCAGCAGTGGCCTC -3'
(R):5'- AGCACTGGTTTCCAAAAATGG -3'
Posted On2015-01-23