Incidental Mutation 'R3703:Fbxl7'
ID258630
Institutional Source Beutler Lab
Gene Symbol Fbxl7
Ensembl Gene ENSMUSG00000043556
Gene NameF-box and leucine-rich repeat protein 7
SynonymsD230018M15Rik, Fbl6, FBL7
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3703 (G1)
Quality Score222
Status Validated
Chromosome15
Chromosomal Location26540459-26895580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26543755 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 269 (G269C)
Ref Sequence ENSEMBL: ENSMUSP00000061305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059204]
Predicted Effect probably damaging
Transcript: ENSMUST00000059204
AA Change: G269C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: G269C

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 73 79 N/A INTRINSIC
FBOX 117 157 2.7e-11 SMART
LRR_CC 185 210 2e-7 SMART
LRR_CC 211 236 2.1e-7 SMART
LRR 237 262 6.3e-7 SMART
LRR 271 296 3.5e-1 SMART
LRR_CC 297 322 1.7e-8 SMART
LRR_CC 323 348 5.5e-8 SMART
LRR_CC 349 374 6.5e-8 SMART
LRR_CC 375 400 9.1e-10 SMART
LRR_CC 401 426 2.1e-8 SMART
LRR_CC 427 452 1.8e-7 SMART
Blast:LRR 453 477 2e-7 BLAST
Meta Mutation Damage Score 0.3308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mug1 C T 6: 121,888,556 probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rab1a T G 11: 20,224,506 probably benign Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Snx9 T A 17: 5,928,200 probably null Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tmprss15 T C 16: 79,054,142 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Trdmt1 T A 2: 13,521,297 Q170L probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Fbxl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Fbxl7 APN 15 26789563 missense probably damaging 0.98
R0482:Fbxl7 UTSW 15 26543546 missense probably benign 0.06
R1734:Fbxl7 UTSW 15 26543649 missense probably damaging 1.00
R1826:Fbxl7 UTSW 15 26552765 missense possibly damaging 0.59
R1859:Fbxl7 UTSW 15 26543193 missense probably damaging 1.00
R2410:Fbxl7 UTSW 15 26895025 missense possibly damaging 0.79
R3704:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R4025:Fbxl7 UTSW 15 26552819 missense probably benign 0.20
R4387:Fbxl7 UTSW 15 26543259 missense probably damaging 1.00
R5055:Fbxl7 UTSW 15 26552936 missense probably damaging 0.98
R5070:Fbxl7 UTSW 15 26789554 missense probably benign 0.15
R5180:Fbxl7 UTSW 15 26543421 missense probably damaging 1.00
R5260:Fbxl7 UTSW 15 26543499 missense probably damaging 1.00
R5720:Fbxl7 UTSW 15 26552893 missense probably damaging 0.98
R6256:Fbxl7 UTSW 15 26553002 missense probably benign 0.16
R6874:Fbxl7 UTSW 15 26552942 missense probably benign
R7143:Fbxl7 UTSW 15 26543158 missense probably benign
R7941:Fbxl7 UTSW 15 26543613 missense probably damaging 1.00
R8848:Fbxl7 UTSW 15 26552816 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGTCACTGACAAAGCGG -3'
(R):5'- ACCGGAAGTGTTAACCCCTG -3'

Sequencing Primer
(F):5'- TGACACTCAGCTCCTTGATGGAAG -3'
(R):5'- ACCCCTGTGTTTTAGCTAGAGAGAAG -3'
Posted On2015-01-23