Incidental Mutation 'R3703:Tmprss15'
ID258632
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3703 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 79054142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably null
Transcript: ENSMUST00000023566
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060402
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mug1 C T 6: 121,888,556 probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rab1a T G 11: 20,224,506 probably benign Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Snx9 T A 17: 5,928,200 probably null Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Trdmt1 T A 2: 13,521,297 Q170L probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- TACCACTCACCAAGCTTCCCATT -3'
(R):5'- AGCAGATGGTAAGACCTCTGTAT -3'

Sequencing Primer
(F):5'- TGCTAGGTCCTATACCTTC -3'
(R):5'- AGCAGTTCTCACAATGGTCTG -3'
Posted On2015-01-23