Incidental Mutation 'R3703:Snx9'
ID258633
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R3703 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 5928200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000002436
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mug1 C T 6: 121,888,556 probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rab1a T G 11: 20,224,506 probably benign Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tmprss15 T C 16: 79,054,142 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Trdmt1 T A 2: 13,521,297 Q170L probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGCCATCCATTACTAGACAG -3'
(R):5'- CACACATGTGCATGGGGATG -3'

Sequencing Primer
(F):5'- TACTAGACAGTGGCACTTGC -3'
(R):5'- TGTTGGGAGGGGACACACC -3'
Posted On2015-01-23