Mutagenetix > Incidental Mutation

Incidental Mutation 'R3704:Zfr2'

258662

Institutional Source

Beutler Lab

Gene Symbol

Zfr2

Ensembl Gene

ENSMUSG00000034949

Gene Name

zinc finger RNA binding protein 2

Synonyms

9130206N08Rik, 2010013I23Rik

MMRRC Submission

040697-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R3704 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

81233155-81252123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 81246079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 493 (V493G)

Ref Sequence

ENSEMBL: ENSMUSP00000113913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117798]

AlphaFold

E9Q5M4

Predicted Effect

probably benign
Transcript: ENSMUST00000117798
AA Change: V493G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: V493G

Domain	Start	End	E-Value	Type
low complexity region	16	23	N/A	INTRINSIC
low complexity region	44	62	N/A	INTRINSIC
low complexity region	123	163	N/A	INTRINSIC
ZnF_U1	202	236	3.58e-5	SMART
ZnF_C2H2	205	229	7.68e0	SMART
ZnF_U1	249	283	3.78e-4	SMART
ZnF_C2H2	252	276	4.12e0	SMART
ZnF_U1	397	431	3.78e-4	SMART
ZnF_C2H2	400	424	1.99e0	SMART
low complexity region	484	508	N/A	INTRINSIC
DZF	585	837	2.06e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132174

Predicted Effect

probably benign
Transcript: ENSMUST00000137999

SMART Domains

Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949

Domain	Start	End	E-Value	Type
Pfam:DZF	2	162	1.3e-32	PFAM
low complexity region	166	178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148029

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 91.8%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Akap13	T	C	7: 75,666,550	C585R	probably damaging	Het
Akr1b10	G	T	6: 34,394,754	D285Y	probably damaging	Het
Akr1b10	A	G	6: 34,394,755	D257G	probably benign	Het
Ankrd17	A	T	5: 90,243,969	N1838K	possibly damaging	Het
Asap3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGAGGAGGA	4: 136,241,241		probably benign	Het
Bcap29	T	C	12: 31,617,152	H170R	probably benign	Het
Brwd3	A	G	X: 108,760,415		probably benign	Het
Capn1	T	C	19: 6,007,371	E349G	probably damaging	Het
Cd27	C	T	6: 125,233,398	C222Y	probably damaging	Het
Cdh12	C	A	15: 21,583,826	T584K	probably damaging	Het
Col13a1	A	G	10: 61,867,829		probably null	Het
Col22a1	T	C	15: 71,970,307	T443A	probably damaging	Het
Crisp3	A	G	17: 40,235,957		probably benign	Het
Cubn	T	A	2: 13,350,943	H1826L	probably damaging	Het
Eci2	A	G	13: 34,993,233		probably benign	Het
Fat2	A	C	11: 55,309,650	F866C	probably damaging	Het
Fbxl7	C	A	15: 26,543,755	G269C	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ifi35	G	A	11: 101,448,604	M1I	probably null	Het
Jarid2	A	G	13: 44,902,355	T308A	probably benign	Het
Kcnq3	A	G	15: 66,021,739		probably null	Het
Kcnt2	C	T	1: 140,533,968	T819M	probably damaging	Het
Kifc3	G	A	8: 95,104,028		probably benign	Het
Mill1	A	G	7: 18,263,053	T190A	possibly damaging	Het
Mosmo	A	G	7: 120,730,605	I150V	probably damaging	Het
Nemf	C	A	12: 69,331,130	D566Y	probably damaging	Het
Nisch	A	G	14: 31,176,745		probably benign	Het
Olfr888	T	A	9: 38,109,003	F106I	possibly damaging	Het
Paip2	A	G	18: 35,610,921	T9A	probably benign	Het
Pde5a	T	C	3: 122,779,019	S318P	probably benign	Het
Plcd1	T	C	9: 119,076,209	I145V	possibly damaging	Het
Prl2c2	C	T	13: 13,002,225	R37H	probably damaging	Het
Raet1e	A	G	10: 22,180,845	T107A	probably benign	Het
Reps1	T	G	10: 18,107,680	F424V	probably damaging	Het
Skint6	A	T	4: 113,136,472	V401D	possibly damaging	Het
Srgn	T	C	10: 62,497,830	D56G	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Ttn	A	T	2: 76,831,780		probably benign	Het
Ugt2b37	A	T	5: 87,242,987	F340L	possibly damaging	Het
Xirp1	T	A	9: 120,016,907	Q970L	probably benign	Het
Zmat4	A	G	8: 23,797,414	R59G	probably benign	Het

Other mutations in Zfr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Zfr2	APN	10	81242085	missense	probably damaging	0.96
IGL01622:Zfr2	APN	10	81251359	missense	probably benign
IGL01623:Zfr2	APN	10	81251359	missense	probably benign
IGL02719:Zfr2	APN	10	81244712	missense	probably damaging	1.00
IGL03036:Zfr2	APN	10	81242151	missense	probably benign	0.01
R0302:Zfr2	UTSW	10	81251336	unclassified	probably benign
R0837:Zfr2	UTSW	10	81245408	missense	probably damaging	1.00
R1557:Zfr2	UTSW	10	81247391	missense	probably benign	0.01
R1714:Zfr2	UTSW	10	81244749	missense	probably damaging	1.00
R1737:Zfr2	UTSW	10	81242085	missense	probably damaging	0.96
R1991:Zfr2	UTSW	10	81242852	missense	possibly damaging	0.86
R2134:Zfr2	UTSW	10	81242901	missense	probably damaging	1.00
R2148:Zfr2	UTSW	10	81242116	missense	probably benign	0.13
R2150:Zfr2	UTSW	10	81242116	missense	probably benign	0.13
R3703:Zfr2	UTSW	10	81246079	missense	probably benign	0.40
R3705:Zfr2	UTSW	10	81246079	missense	probably benign	0.40
R3715:Zfr2	UTSW	10	81246079	missense	probably benign	0.40
R4301:Zfr2	UTSW	10	81242184	unclassified	probably benign
R4654:Zfr2	UTSW	10	81251249	splice site	probably null
R4811:Zfr2	UTSW	10	81243713	missense	probably benign	0.07
R5290:Zfr2	UTSW	10	81246710	frame shift	probably null
R5781:Zfr2	UTSW	10	81243713	missense	probably benign	0.07
R7114:Zfr2	UTSW	10	81244725	missense	probably damaging	1.00
R8192:Zfr2	UTSW	10	81242815	missense	possibly damaging	0.83
R8359:Zfr2	UTSW	10	81242819	missense	possibly damaging	0.57
R8389:Zfr2	UTSW	10	81245489	missense	probably benign
R8827:Zfr2	UTSW	10	81242785	missense	probably benign	0.00
R8953:Zfr2	UTSW	10	81248437	missense	probably damaging	0.99
R9086:Zfr2	UTSW	10	81240195	missense	probably damaging	0.96
R9189:Zfr2	UTSW	10	81244662	missense	probably damaging	1.00
R9487:Zfr2	UTSW	10	81240135	missense	probably benign	0.33
R9592:Zfr2	UTSW	10	81233746	missense	unknown
R9645:Zfr2	UTSW	10	81248418	nonsense	probably null
X0063:Zfr2	UTSW	10	81242957	critical splice donor site	probably null
Z1177:Zfr2	UTSW	10	81246084	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTCTGATGCCCCATGATC -3'
(R):5'- ACAGACATGCTATGCTGGAC -3'

Sequencing Primer
(F):5'- GATGCCCCATGATCCCTGAC -3'
(R):5'- ATGCTATGCTGGACCCACAG -3'

Posted On

2015-01-23