Incidental Mutation 'R3704:Ifi35'
ID258666
Institutional Source Beutler Lab
Gene Symbol Ifi35
Ensembl Gene ENSMUSG00000010358
Gene Nameinterferon-induced protein 35
SynonymsIFP35, 2010008K16Rik
MMRRC Submission 040697-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R3704 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101448407-101458698 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 101448604 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000010502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010502] [ENSMUST00000077856] [ENSMUST00000107249] [ENSMUST00000127514] [ENSMUST00000131024]
Predicted Effect probably null
Transcript: ENSMUST00000010502
AA Change: M1I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000010502
Gene: ENSMUSG00000010358
AA Change: M1I

DomainStartEndE-ValueType
Pfam:IFP_35_N 8 80 9.1e-21 PFAM
Pfam:NID 81 170 1.5e-31 PFAM
Pfam:NID 179 266 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077856
SMART Domains Protein: ENSMUSP00000090305
Gene: ENSMUSG00000063316

DomainStartEndE-ValueType
KOW 4 31 2.14e-3 SMART
Pfam:Ribosomal_L27e 52 136 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107249
SMART Domains Protein: ENSMUSP00000102870
Gene: ENSMUSG00000063316

DomainStartEndE-ValueType
KOW 4 31 2.14e-3 SMART
Pfam:Ribosomal_L27e 52 136 1.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125958
Predicted Effect probably benign
Transcript: ENSMUST00000127514
SMART Domains Protein: ENSMUSP00000120418
Gene: ENSMUSG00000063316

DomainStartEndE-ValueType
Pfam:Ribosomal_L27e 1 32 5.3e-12 PFAM
Pfam:Ribosomal_L27e 30 87 1.2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131024
AA Change: M1I
SMART Domains Protein: ENSMUSP00000117189
Gene: ENSMUSG00000010358
AA Change: M1I

DomainStartEndE-ValueType
Pfam:IFP_35_N 8 45 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152162
Meta Mutation Damage Score 0.8579 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Akap13 T C 7: 75,666,550 C585R probably damaging Het
Akr1b10 G T 6: 34,394,754 D285Y probably damaging Het
Akr1b10 A G 6: 34,394,755 D257G probably benign Het
Ankrd17 A T 5: 90,243,969 N1838K possibly damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cd27 C T 6: 125,233,398 C222Y probably damaging Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col22a1 T C 15: 71,970,307 T443A probably damaging Het
Crisp3 A G 17: 40,235,957 probably benign Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Eci2 A G 13: 34,993,233 probably benign Het
Fat2 A C 11: 55,309,650 F866C probably damaging Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Jarid2 A G 13: 44,902,355 T308A probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kcnt2 C T 1: 140,533,968 T819M probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Mill1 A G 7: 18,263,053 T190A possibly damaging Het
Mosmo A G 7: 120,730,605 I150V probably damaging Het
Nemf C A 12: 69,331,130 D566Y probably damaging Het
Nisch A G 14: 31,176,745 probably benign Het
Olfr888 T A 9: 38,109,003 F106I possibly damaging Het
Paip2 A G 18: 35,610,921 T9A probably benign Het
Pde5a T C 3: 122,779,019 S318P probably benign Het
Plcd1 T C 9: 119,076,209 I145V possibly damaging Het
Prl2c2 C T 13: 13,002,225 R37H probably damaging Het
Raet1e A G 10: 22,180,845 T107A probably benign Het
Reps1 T G 10: 18,107,680 F424V probably damaging Het
Skint6 A T 4: 113,136,472 V401D possibly damaging Het
Srgn T C 10: 62,497,830 D56G probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ttn A T 2: 76,831,780 probably benign Het
Ugt2b37 A T 5: 87,242,987 F340L possibly damaging Het
Xirp1 T A 9: 120,016,907 Q970L probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zmat4 A G 8: 23,797,414 R59G probably benign Het
Other mutations in Ifi35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ifi35 APN 11 101457326 missense probably damaging 0.99
R0362:Ifi35 UTSW 11 101457212 missense probably benign 0.02
R1753:Ifi35 UTSW 11 101456635 missense probably damaging 1.00
R1982:Ifi35 UTSW 11 101458286 missense probably damaging 0.99
R3522:Ifi35 UTSW 11 101457685 missense probably benign 0.25
R4553:Ifi35 UTSW 11 101457891 missense probably damaging 1.00
R5864:Ifi35 UTSW 11 101458243 missense probably damaging 1.00
R7222:Ifi35 UTSW 11 101457515 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCAGAATTCACAGAAATG -3'
(R):5'- ACTTTAGGTGTCAGAGTCCTGG -3'

Sequencing Primer
(F):5'- GCAGAATTCACAGAAATGAAAGTG -3'
(R):5'- CAGAGTCCTGGTTTTGACAATAG -3'
Posted On2015-01-23