Incidental Mutation 'R3704:Prl2c2'
ID258669
Institutional Source Beutler Lab
Gene Symbol Prl2c2
Ensembl Gene ENSMUSG00000079092
Gene Nameprolactin family 2, subfamily c, member 2
SynonymsPlf, Plf1, MRP-1, PLF-1
MMRRC Submission 040697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3704 (G1)
Quality Score120
Status Validated
Chromosome13
Chromosomal Location12996125-13005383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13002225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 37 (R37H)
Ref Sequence ENSEMBL: ENSMUSP00000152202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110594] [ENSMUST00000220558] [ENSMUST00000221612] [ENSMUST00000221627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110594
AA Change: R39H

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106224
Gene: ENSMUSG00000079092
AA Change: R39H

DomainStartEndE-ValueType
Pfam:Hormone_1 16 224 9.2e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220558
AA Change: R37H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221612
AA Change: R39H

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000221627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223124
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Akap13 T C 7: 75,666,550 C585R probably damaging Het
Akr1b10 G T 6: 34,394,754 D285Y probably damaging Het
Akr1b10 A G 6: 34,394,755 D257G probably benign Het
Ankrd17 A T 5: 90,243,969 N1838K possibly damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cd27 C T 6: 125,233,398 C222Y probably damaging Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col22a1 T C 15: 71,970,307 T443A probably damaging Het
Crisp3 A G 17: 40,235,957 probably benign Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Eci2 A G 13: 34,993,233 probably benign Het
Fat2 A C 11: 55,309,650 F866C probably damaging Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifi35 G A 11: 101,448,604 M1I probably null Het
Jarid2 A G 13: 44,902,355 T308A probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kcnt2 C T 1: 140,533,968 T819M probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Mill1 A G 7: 18,263,053 T190A possibly damaging Het
Mosmo A G 7: 120,730,605 I150V probably damaging Het
Nemf C A 12: 69,331,130 D566Y probably damaging Het
Nisch A G 14: 31,176,745 probably benign Het
Olfr888 T A 9: 38,109,003 F106I possibly damaging Het
Paip2 A G 18: 35,610,921 T9A probably benign Het
Pde5a T C 3: 122,779,019 S318P probably benign Het
Plcd1 T C 9: 119,076,209 I145V possibly damaging Het
Raet1e A G 10: 22,180,845 T107A probably benign Het
Reps1 T G 10: 18,107,680 F424V probably damaging Het
Skint6 A T 4: 113,136,472 V401D possibly damaging Het
Srgn T C 10: 62,497,830 D56G probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ttn A T 2: 76,831,780 probably benign Het
Ugt2b37 A T 5: 87,242,987 F340L possibly damaging Het
Xirp1 T A 9: 120,016,907 Q970L probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zmat4 A G 8: 23,797,414 R59G probably benign Het
Other mutations in Prl2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Prl2c2 APN 13 13002243 missense probably damaging 1.00
R0991:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R0993:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1139:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1196:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1250:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1319:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1321:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1325:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1341:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1382:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1415:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1494:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1878:Prl2c2 UTSW 13 13005326 start codon destroyed probably damaging 0.99
R1950:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1983:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1999:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R4972:Prl2c2 UTSW 13 13002170 missense possibly damaging 0.74
R6170:Prl2c2 UTSW 13 13002172 missense probably damaging 0.99
R6766:Prl2c2 UTSW 13 13002128 splice site probably null
R7426:Prl2c2 UTSW 13 12997480 splice site probably null
R7635:Prl2c2 UTSW 13 12997343 missense probably damaging 0.98
R7842:Prl2c2 UTSW 13 13005322 missense probably benign 0.13
X0065:Prl2c2 UTSW 13 13002175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGCCTATAGTTCAGTAGTTGC -3'
(R):5'- CTGTGACCACAAGAAGGATTCC -3'

Sequencing Primer
(F):5'- CCTATAGTTCAGTAGTTGCTGTGTTC -3'
(R):5'- GTGACCACAAGAAGGATTCCATTGAC -3'
Posted On2015-01-23