Mutagenetix > Incidental Mutations

Incidental Mutation 'R3704:Jarid2'

258671

Institutional Source

Beutler Lab

Gene Symbol

Jarid2

Ensembl Gene

ENSMUSG00000038518

Gene Name

jumonji, AT rich interactive domain 2

Synonyms

jumonji, Jmj

MMRRC Submission

040697-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3704 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44729474-44921643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44902355 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 308 (T308A)

Ref Sequence

ENSEMBL: ENSMUSP00000134630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]

Predicted Effect

probably benign
Transcript: ENSMUST00000044608
AA Change: T346A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: T346A

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173246
AA Change: T346A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: T346A

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173367
AA Change: T207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: T207A

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
low complexity region	126	146	N/A	INTRINSIC
low complexity region	195	214	N/A	INTRINSIC
JmjN	415	456	1.77e-20	SMART
PDB:2RQ5\|A	476	507	3e-14	PDB
Blast:ARID	477	507	2e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173704
AA Change: T346A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: T346A

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1190	1e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173906
AA Change: T308A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: T308A

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	143	157	N/A	INTRINSIC
low complexity region	227	247	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC
JmjN	516	557	1.77e-20	SMART
ARID	578	669	4.96e-24	SMART
BRIGHT	582	674	1.7e-29	SMART
low complexity region	753	762	N/A	INTRINSIC
JmjC	844	1008	1.04e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174683

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 91.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Akap13	T	C	7: 75,666,550	C585R	probably damaging	Het
Akr1b10	G	T	6: 34,394,754	D285Y	probably damaging	Het
Akr1b10	A	G	6: 34,394,755	D257G	probably benign	Het
Ankrd17	A	T	5: 90,243,969	N1838K	possibly damaging	Het
Asap3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGAGGAGGA	4: 136,241,241		probably benign	Het
Bcap29	T	C	12: 31,617,152	H170R	probably benign	Het
Brwd3	A	G	X: 108,760,415		probably benign	Het
Capn1	T	C	19: 6,007,371	E349G	probably damaging	Het
Cd27	C	T	6: 125,233,398	C222Y	probably damaging	Het
Cdh12	C	A	15: 21,583,826	T584K	probably damaging	Het
Col13a1	A	G	10: 61,867,829		probably null	Het
Col22a1	T	C	15: 71,970,307	T443A	probably damaging	Het
Crisp3	A	G	17: 40,235,957		probably benign	Het
Cubn	T	A	2: 13,350,943	H1826L	probably damaging	Het
Eci2	A	G	13: 34,993,233		probably benign	Het
Fat2	A	C	11: 55,309,650	F866C	probably damaging	Het
Fbxl7	C	A	15: 26,543,755	G269C	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ifi35	G	A	11: 101,448,604	M1I	probably null	Het
Kcnq3	A	G	15: 66,021,739		probably null	Het
Kcnt2	C	T	1: 140,533,968	T819M	probably damaging	Het
Kifc3	G	A	8: 95,104,028		probably benign	Het
Mill1	A	G	7: 18,263,053	T190A	possibly damaging	Het
Mosmo	A	G	7: 120,730,605	I150V	probably damaging	Het
Nemf	C	A	12: 69,331,130	D566Y	probably damaging	Het
Nisch	A	G	14: 31,176,745		probably benign	Het
Olfr888	T	A	9: 38,109,003	F106I	possibly damaging	Het
Paip2	A	G	18: 35,610,921	T9A	probably benign	Het
Pde5a	T	C	3: 122,779,019	S318P	probably benign	Het
Plcd1	T	C	9: 119,076,209	I145V	possibly damaging	Het
Prl2c2	C	T	13: 13,002,225	R37H	probably damaging	Het
Raet1e	A	G	10: 22,180,845	T107A	probably benign	Het
Reps1	T	G	10: 18,107,680	F424V	probably damaging	Het
Skint6	A	T	4: 113,136,472	V401D	possibly damaging	Het
Srgn	T	C	10: 62,497,830	D56G	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Ttn	A	T	2: 76,831,780		probably benign	Het
Ugt2b37	A	T	5: 87,242,987	F340L	possibly damaging	Het
Xirp1	T	A	9: 120,016,907	Q970L	probably benign	Het
Zfr2	T	G	10: 81,246,079	V493G	probably benign	Het
Zmat4	A	G	8: 23,797,414	R59G	probably benign	Het

Other mutations in Jarid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Jarid2	APN	13	44884835	missense	probably damaging	1.00
IGL02217:Jarid2	APN	13	44913201	missense	probably damaging	1.00
IGL02378:Jarid2	APN	13	44914325	missense	probably damaging	0.98
IGL02604:Jarid2	APN	13	44874401	missense	probably damaging	1.00
IGL02865:Jarid2	APN	13	44910560	missense	probably damaging	1.00
IGL02926:Jarid2	APN	13	44902929	missense	probably benign	0.03
R0057:Jarid2	UTSW	13	44884856	missense	probably damaging	0.96
R0426:Jarid2	UTSW	13	44840882	critical splice donor site	probably null
R0545:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R0562:Jarid2	UTSW	13	44902359	missense	probably damaging	0.99
R1192:Jarid2	UTSW	13	44906545	missense	probably damaging	1.00
R1241:Jarid2	UTSW	13	44884892	splice site	probably benign
R1254:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1552:Jarid2	UTSW	13	44911199	missense	probably damaging	1.00
R1728:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1729:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1730:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1739:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1783:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1785:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1844:Jarid2	UTSW	13	44902743	missense	possibly damaging	0.71
R1896:Jarid2	UTSW	13	44884882	critical splice donor site	probably null
R1965:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1966:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1995:Jarid2	UTSW	13	44874441	missense	probably damaging	1.00
R2120:Jarid2	UTSW	13	44906336	missense	probably benign	0.17
R2142:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2172:Jarid2	UTSW	13	44902539	missense	probably damaging	0.99
R2242:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2245:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3110:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3111:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3112:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3115:Jarid2	UTSW	13	44896466	missense	probably damaging	1.00
R3620:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3802:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R3804:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R4126:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4127:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4128:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4153:Jarid2	UTSW	13	44910426	missense	probably damaging	1.00
R4844:Jarid2	UTSW	13	44913772	missense	probably damaging	0.96
R5044:Jarid2	UTSW	13	44906565	missense	probably damaging	1.00
R5329:Jarid2	UTSW	13	44906271	missense	possibly damaging	0.49
R5632:Jarid2	UTSW	13	44896290	missense	probably damaging	0.97
R5820:Jarid2	UTSW	13	44902301	missense	possibly damaging	0.96
R6267:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6296:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6479:Jarid2	UTSW	13	44848289	missense	probably benign	0.22
R6619:Jarid2	UTSW	13	44874396	missense	probably damaging	1.00
R6633:Jarid2	UTSW	13	44884877	missense	probably damaging	0.97
R6970:Jarid2	UTSW	13	44902985	missense	probably damaging	1.00
R7020:Jarid2	UTSW	13	44884824	missense	probably damaging	1.00
R7155:Jarid2	UTSW	13	44902462	missense	probably damaging	1.00
R7223:Jarid2	UTSW	13	44896322	missense	possibly damaging	0.89
R7265:Jarid2	UTSW	13	44902272	missense	probably benign	0.29
R8321:Jarid2	UTSW	13	44848386	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACTGGATTTGCCTGGGTAC -3'
(R):5'- ACTTTGGGTTCAACCTGCTG -3'

Sequencing Primer
(F):5'- ACTGGATTTGCCTGGGTACTAATTC -3'
(R):5'- AACCTGCTGCTGGCCTTG -3'

Posted On

2015-01-23