Incidental Mutation 'R3705:Hdac4'
ID258682
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 91934694 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644]
Predicted Effect probably benign
Transcript: ENSMUST00000008995
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191327
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0288:Hdac4 UTSW 1 91971006 missense probably damaging 1.00
R0334:Hdac4 UTSW 1 91956038 splice site probably benign
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1732:Hdac4 UTSW 1 91947535 missense probably benign 0.01
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R2384:Hdac4 UTSW 1 91984485 missense probably benign 0.02
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R4440:Hdac4 UTSW 1 91945995 missense probably damaging 1.00
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 intron probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
R7002:Hdac4 UTSW 1 91968361 missense possibly damaging 0.85
R7781:Hdac4 UTSW 1 91975665 missense probably benign 0.41
R8156:Hdac4 UTSW 1 91958416 missense probably damaging 0.99
Z1177:Hdac4 UTSW 1 91956047 missense probably damaging 1.00
Z1177:Hdac4 UTSW 1 91987611 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTTCAGGGAGTCTCTACTAGC -3'
(R):5'- TCCAGTGTACCCTAAGGAGAGAC -3'

Sequencing Primer
(F):5'- AGGGAGTCTCTACTAGCTGATCAC -3'
(R):5'- TGTACCCTAAGGAGAGACTACCTG -3'
Posted On2015-01-23