Incidental Mutation 'R3705:Tmem63a'
ID258684
Institutional Source Beutler Lab
Gene Symbol Tmem63a
Ensembl Gene ENSMUSG00000026519
Gene Nametransmembrane protein 63a
Synonyms
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180942344-180975112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180963114 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 446 (D446N)
Ref Sequence ENSEMBL: ENSMUSP00000124021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000161523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027800
AA Change: D446N

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519
AA Change: D446N

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128545
Predicted Effect possibly damaging
Transcript: ENSMUST00000161523
AA Change: D446N

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124021
Gene: ENSMUSG00000026519
AA Change: D446N

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.6e-25 PFAM
Pfam:DUF4463 261 326 9.4e-15 PFAM
Pfam:DUF221 349 692 1.4e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161942
Meta Mutation Damage Score 0.6253 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Tmem63a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Tmem63a APN 1 180963088 missense probably damaging 1.00
IGL00331:Tmem63a APN 1 180966497 missense possibly damaging 0.46
IGL01116:Tmem63a APN 1 180972089 missense probably damaging 0.96
IGL01368:Tmem63a APN 1 180970232 missense possibly damaging 0.69
IGL01445:Tmem63a APN 1 180946631 missense probably damaging 1.00
IGL01867:Tmem63a APN 1 180956005 missense possibly damaging 0.87
IGL02043:Tmem63a APN 1 180972788 missense probably benign 0.11
IGL02453:Tmem63a APN 1 180963069 missense probably benign 0.02
IGL02527:Tmem63a APN 1 180952974 splice site probably null
IGL02811:Tmem63a APN 1 180965783 missense probably damaging 0.99
IGL02975:Tmem63a APN 1 180961075 missense probably benign
IGL03304:Tmem63a APN 1 180968853 nonsense probably null
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0173:Tmem63a UTSW 1 180954798 splice site probably benign
R0358:Tmem63a UTSW 1 180956423 missense probably benign 0.17
R0436:Tmem63a UTSW 1 180972733 missense probably benign 0.03
R0506:Tmem63a UTSW 1 180958049 critical splice donor site probably null
R0513:Tmem63a UTSW 1 180960461 missense probably benign 0.00
R0529:Tmem63a UTSW 1 180961094 missense probably benign 0.09
R0855:Tmem63a UTSW 1 180961060 missense possibly damaging 0.82
R1633:Tmem63a UTSW 1 180948826 missense probably damaging 0.98
R2129:Tmem63a UTSW 1 180965540 missense probably benign 0.00
R2212:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R2214:Tmem63a UTSW 1 180961114 missense probably benign 0.00
R2413:Tmem63a UTSW 1 180961075 missense probably benign
R2437:Tmem63a UTSW 1 180962489 splice site probably null
R3703:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3704:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3714:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3746:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3747:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3961:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3963:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R4675:Tmem63a UTSW 1 180956491 missense probably benign 0.00
R4795:Tmem63a UTSW 1 180954851 missense probably damaging 1.00
R4876:Tmem63a UTSW 1 180973186 missense probably benign
R4916:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4917:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4918:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R5620:Tmem63a UTSW 1 180970246 missense probably benign 0.00
R5843:Tmem63a UTSW 1 180972833 critical splice donor site probably null
R5937:Tmem63a UTSW 1 180961151 missense probably damaging 1.00
R6823:Tmem63a UTSW 1 180960470 missense possibly damaging 0.60
R6990:Tmem63a UTSW 1 180961121 missense probably benign 0.02
R7075:Tmem63a UTSW 1 180961149 missense probably damaging 1.00
R7129:Tmem63a UTSW 1 180954876 missense probably damaging 0.98
R7447:Tmem63a UTSW 1 180958023 missense probably benign 0.04
R7609:Tmem63a UTSW 1 180952974 splice site probably null
R8116:Tmem63a UTSW 1 180960483 missense probably benign 0.04
R8141:Tmem63a UTSW 1 180974211 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCGGATGTCCATGTCTGAG -3'
(R):5'- GCTTTCAGCTTAAAAGGCCAAATG -3'

Sequencing Primer
(F):5'- AGAGACTAAGCCTCTCTCTCGG -3'
(R):5'- TGCTGTGCAAGTATGAAATCCCC -3'
Posted On2015-01-23