Incidental Mutation 'R3705:Olfr153'
ID258687
Institutional Source Beutler Lab
Gene Symbol Olfr153
Ensembl Gene ENSMUSG00000061520
Gene Nameolfactory receptor 153
SynonymsGA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr4-2, V5
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87531796-87533053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87532068 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 12 (I12V)
Ref Sequence ENSEMBL: ENSMUSP00000149859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000217113]
Predicted Effect probably benign
Transcript: ENSMUST00000077471
AA Change: I12V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: I12V

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217113
AA Change: I12V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Olfr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Olfr153 APN 2 87532285 missense probably benign 0.01
IGL02102:Olfr153 APN 2 87532461 missense probably benign
IGL02604:Olfr153 APN 2 87532605 missense probably damaging 0.98
IGL02695:Olfr153 APN 2 87532117 missense probably benign 0.00
IGL02961:Olfr153 APN 2 87532684 missense probably damaging 0.98
PIT4696001:Olfr153 UTSW 2 87532780 missense probably damaging 1.00
R0727:Olfr153 UTSW 2 87532901 nonsense probably null
R1534:Olfr153 UTSW 2 87532672 missense probably damaging 0.99
R1699:Olfr153 UTSW 2 87532083 missense probably benign 0.07
R1885:Olfr153 UTSW 2 87532824 missense probably damaging 0.99
R5664:Olfr153 UTSW 2 87532834 missense probably benign 0.35
R6492:Olfr153 UTSW 2 87532741 missense possibly damaging 0.66
R6808:Olfr153 UTSW 2 87532941 missense probably benign
R7432:Olfr153 UTSW 2 87532440 missense probably damaging 1.00
R7477:Olfr153 UTSW 2 87532087 missense probably benign 0.00
R8014:Olfr153 UTSW 2 87532164 missense probably benign 0.13
X0028:Olfr153 UTSW 2 87532039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACTGTCCATCCCAGATATTG -3'
(R):5'- TCACAGAAAGACAAGTGGCTC -3'

Sequencing Primer
(F):5'- GTCCATCCCAGATATTGGTCATTTTG -3'
(R):5'- CTCAGGAAAAAGTACATGGGTGTGTG -3'
Posted On2015-01-23