Incidental Mutation 'R0326:Ctnnb1'
ID25869
Institutional Source Beutler Lab
Gene Symbol Ctnnb1
Ensembl Gene ENSMUSG00000006932
Gene Namecatenin (cadherin associated protein), beta 1
Synonymsbeta-catenin, Catnb, beta catenin
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120929216-120960507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120951712 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 99 (Q99K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000163844] [ENSMUST00000178812]
Predicted Effect probably benign
Transcript: ENSMUST00000007130
AA Change: N287K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: N287K

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126633
Predicted Effect probably benign
Transcript: ENSMUST00000130466
Predicted Effect probably benign
Transcript: ENSMUST00000130845
SMART Domains Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 80 2e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133689
SMART Domains Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 41 2e-20 BLAST
Pfam:Arm 42 82 4.4e-9 PFAM
Blast:ARM 83 123 9e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145093
SMART Domains Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 174 1e-113 PDB
SCOP:d1gw5a_ 90 172 5e-8 SMART
Blast:ARM 141 174 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154356
AA Change: N287K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: N287K

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 562 3e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156911
Predicted Effect probably benign
Transcript: ENSMUST00000163844
SMART Domains Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 72 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169931
SMART Domains Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
ARM 2 36 3.8e1 SMART
ARM 41 82 7.34e-3 SMART
ARM 83 144 1.92e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170729
AA Change: Q99K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932
AA Change: Q99K

DomainStartEndE-ValueType
Blast:ARM 2 35 4e-15 BLAST
PDB:3SLA|E 2 87 1e-57 PDB
SCOP:d1jdha_ 2 89 2e-12 SMART
Blast:ARM 36 78 2e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178812
AA Change: N287K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: N287K

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213408
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Ctnnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0092:Ctnnb1 UTSW 9 120952863 missense possibly damaging 0.78
R0561:Ctnnb1 UTSW 9 120951722 missense probably damaging 0.97
R1017:Ctnnb1 UTSW 9 120950728 missense probably damaging 0.99
R1918:Ctnnb1 UTSW 9 120951034 missense possibly damaging 0.80
R3892:Ctnnb1 UTSW 9 120950514 splice site probably benign
R3915:Ctnnb1 UTSW 9 120955651 missense probably benign 0.00
R4869:Ctnnb1 UTSW 9 120952994 missense possibly damaging 0.93
R5707:Ctnnb1 UTSW 9 120955168 missense probably benign 0.01
R6744:Ctnnb1 UTSW 9 120952959 missense probably damaging 0.99
R7466:Ctnnb1 UTSW 9 120955416 missense probably damaging 1.00
R7707:Ctnnb1 UTSW 9 120952865 missense possibly damaging 0.77
R8434:Ctnnb1 UTSW 9 120957562 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGGACTCTGCACAACCTTTCTCAC -3'
(R):5'- ATGCTTAGCACCGTACTGTACACAC -3'

Sequencing Primer
(F):5'- ATCTTTAAGTCTGGTGGCATCC -3'
(R):5'- CGTACTGTACACACAGATTCAATGTC -3'
Posted On2013-04-16