Incidental Mutation 'R3705:Pdgfc'
ID258691
Institutional Source Beutler Lab
Gene Symbol Pdgfc
Ensembl Gene ENSMUSG00000028019
Gene Nameplatelet-derived growth factor, C polypeptide
SynonymsPDGF-C, 1110064L01Rik
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location81036416-81214040 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 81204444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029652] [ENSMUST00000129285] [ENSMUST00000143721]
Predicted Effect probably null
Transcript: ENSMUST00000029652
SMART Domains Protein: ENSMUSP00000029652
Gene: ENSMUSG00000028019

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 46 163 2.43e-23 SMART
low complexity region 172 186 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
PDGF 249 339 3.62e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129285
SMART Domains Protein: ENSMUSP00000118970
Gene: ENSMUSG00000028019

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143721
SMART Domains Protein: ENSMUSP00000122047
Gene: ENSMUSG00000028019

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines. This gene product appears to form only homodimers. It differs from the platelet-derived growth factor alpha and beta polypeptides in having an unusual N-terminal domain, the CUB domain. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutation of this gene results neonatal and postnatal lethality with cleft palate, hypoplastic palatine bones, edema, blistering, and a short nasal septum with one allele or abnormal retinal pigmentation with a second allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Pdgfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Pdgfc APN 3 81141443 missense probably benign 0.01
IGL01467:Pdgfc APN 3 81209091 missense probably damaging 1.00
IGL01897:Pdgfc APN 3 81204332 missense possibly damaging 0.71
IGL02732:Pdgfc APN 3 81037557 splice site probably benign
PIT4403001:Pdgfc UTSW 3 81174961 missense probably damaging 1.00
R1505:Pdgfc UTSW 3 81209236 missense possibly damaging 0.89
R1619:Pdgfc UTSW 3 81174887 missense probably benign 0.03
R1964:Pdgfc UTSW 3 81174985 missense probably benign 0.34
R1975:Pdgfc UTSW 3 81209245 missense probably damaging 0.99
R1977:Pdgfc UTSW 3 81209245 missense probably damaging 0.99
R3775:Pdgfc UTSW 3 81141551 missense probably damaging 1.00
R3776:Pdgfc UTSW 3 81141551 missense probably damaging 1.00
R4381:Pdgfc UTSW 3 81209251 missense probably damaging 1.00
R4504:Pdgfc UTSW 3 81174991 missense probably benign
R4583:Pdgfc UTSW 3 81141528 missense possibly damaging 0.69
R7092:Pdgfc UTSW 3 81204352 missense probably damaging 1.00
R8196:Pdgfc UTSW 3 81037504 missense not run
Predicted Primers PCR Primer
(F):5'- TTTCACTTTCAGCAAGTCACAG -3'
(R):5'- TGCTGAGACAGGAATGACTG -3'

Sequencing Primer
(F):5'- GAGTCCTTCGGTGTTGCCC -3'
(R):5'- CAGGAATGACTGGAATTTTCAGC -3'
Posted On2015-01-23