Incidental Mutation 'R3705:Sf3b4'
ID258692
Institutional Source Beutler Lab
Gene Symbol Sf3b4
Ensembl Gene ENSMUSG00000068856
Gene Namesplicing factor 3b, subunit 4
SynonymsSF3b49, 49kDa, Sap49
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96172332-96177564 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 96176628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035371] [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000035371
SMART Domains Protein: ENSMUSP00000037576
Gene: ENSMUSG00000038486

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
Pfam:Sugar_tr 149 484 5.3e-30 PFAM
Pfam:MFS_1 168 483 1.6e-24 PFAM
Pfam:Pentapeptide_4 513 585 7.7e-11 PFAM
Pfam:MFS_1 561 739 3.9e-12 PFAM
Pfam:Sugar_tr 588 742 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054356
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122737
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes one of the subunits of splicing factor 3B. A similar gene in human encodes a protein that cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes, and also belongs with the minor U12-dependent spliceosome. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Sf3b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02330:Sf3b4 APN 3 96173060 missense possibly damaging 0.84
R0385:Sf3b4 UTSW 3 96172982 missense probably damaging 0.98
R0494:Sf3b4 UTSW 3 96173701 missense probably damaging 0.98
R1403:Sf3b4 UTSW 3 96173637 unclassified probably null
R1403:Sf3b4 UTSW 3 96173637 unclassified probably null
R5305:Sf3b4 UTSW 3 96173642 missense probably damaging 1.00
R6360:Sf3b4 UTSW 3 96176728 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATCTCTCTGTTTAAGTCAGAAGG -3'
(R):5'- AGATCCAAAAGGAGGCCCTC -3'

Sequencing Primer
(F):5'- TCTGATGTGCTAAATAAACCTGGGG -3'
(R):5'- CAGGATGAGGCATTCCA -3'
Posted On2015-01-23