Incidental Mutation 'R0328:Fbxw21'
ID25870
Institutional Source Beutler Lab
Gene Symbol Fbxw21
Ensembl Gene ENSMUSG00000047237
Gene NameF-box and WD-40 domain protein 21
SynonymsE330009P21Rik
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109139447-109162041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109146585 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 248 (I248F)
Ref Sequence ENSEMBL: ENSMUSP00000143095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054925] [ENSMUST00000198076] [ENSMUST00000199540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054925
AA Change: I248F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237
AA Change: I248F

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197401
Predicted Effect possibly damaging
Transcript: ENSMUST00000198076
AA Change: I248F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143095
Gene: ENSMUSG00000047237
AA Change: I248F

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 9e-8 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199540
SMART Domains Protein: ENSMUSP00000143200
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 9e-9 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Fbxw21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Fbxw21 APN 9 109161964 missense probably damaging 1.00
IGL00901:Fbxw21 APN 9 109156399 missense probably benign 0.00
IGL01377:Fbxw21 APN 9 109146645 nonsense probably null
IGL01941:Fbxw21 APN 9 109148156 missense probably benign 0.07
IGL02491:Fbxw21 APN 9 109143819 missense probably benign
IGL03163:Fbxw21 APN 9 109145484 missense probably benign 0.01
IGL03377:Fbxw21 APN 9 109139529 missense probably benign 0.01
R0148:Fbxw21 UTSW 9 109148017 critical splice donor site probably null
R0909:Fbxw21 UTSW 9 109156408 missense possibly damaging 0.84
R1506:Fbxw21 UTSW 9 109148189 missense probably damaging 1.00
R1575:Fbxw21 UTSW 9 109161916 missense probably benign 0.00
R1615:Fbxw21 UTSW 9 109143726 missense probably damaging 1.00
R1719:Fbxw21 UTSW 9 109148174 missense possibly damaging 0.85
R2415:Fbxw21 UTSW 9 109156401 missense possibly damaging 0.71
R2424:Fbxw21 UTSW 9 109157519 nonsense probably null
R2508:Fbxw21 UTSW 9 109145485 missense probably benign 0.31
R2898:Fbxw21 UTSW 9 109156336 missense possibly damaging 0.52
R2964:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2965:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2966:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R4809:Fbxw21 UTSW 9 109143390 missense probably damaging 1.00
R4911:Fbxw21 UTSW 9 109145663 missense probably damaging 1.00
R5669:Fbxw21 UTSW 9 109145510 missense probably benign 0.12
R5928:Fbxw21 UTSW 9 109143825 missense possibly damaging 0.55
R6043:Fbxw21 UTSW 9 109145539 missense possibly damaging 0.69
R6277:Fbxw21 UTSW 9 109145555 missense possibly damaging 0.95
R6805:Fbxw21 UTSW 9 109157565 missense probably damaging 1.00
R6944:Fbxw21 UTSW 9 109157535 missense probably damaging 1.00
R7079:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R7081:Fbxw21 UTSW 9 109161922 missense probably damaging 1.00
Z1088:Fbxw21 UTSW 9 109145537 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGACTGAGCCACATTTCAAGG -3'
(R):5'- ACCAGGTGCTGCTGCTCTGATTTC -3'

Sequencing Primer
(F):5'- CTGAGCCACATTTCAAGGATACTTC -3'
(R):5'- TCAGATAGGTGATACCTTGGGTAAC -3'
Posted On2013-04-16