Incidental Mutation 'R3705:Rcc1l'
ID258701
Institutional Source Beutler Lab
Gene Symbol Rcc1l
Ensembl Gene ENSMUSG00000061979
Gene Namereculator of chromosome condensation 1 like
SynonymsWbscr16, 5730496C04Rik
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134148054-134176774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134154191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 414 (V414E)
Ref Sequence ENSEMBL: ENSMUSP00000075581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076228]
Predicted Effect probably damaging
Transcript: ENSMUST00000076228
AA Change: V414E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075581
Gene: ENSMUSG00000061979
AA Change: V414E

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 28 40 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:RCC1 127 186 2.3e-10 PFAM
Pfam:RCC1_2 173 202 1e-9 PFAM
Pfam:RCC1 190 242 5.6e-11 PFAM
Pfam:RCC1_2 229 258 2.9e-12 PFAM
Pfam:RCC1 245 295 5.1e-8 PFAM
Pfam:RCC1 298 348 2e-12 PFAM
Pfam:RCC1_2 391 422 2.6e-9 PFAM
Pfam:RCC1 409 456 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126113
Meta Mutation Damage Score 0.7093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing regulator of chromosome condensation 1-like repeats. The encoded protein may function as a guanine nucleotide exchange factor. This gene is located in a region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Rcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0563:Rcc1l UTSW 5 134176555 missense probably benign 0.16
R1834:Rcc1l UTSW 5 134163659 missense probably damaging 1.00
R2108:Rcc1l UTSW 5 134155790 missense probably benign 0.00
R2512:Rcc1l UTSW 5 134166669 missense probably damaging 0.98
R4192:Rcc1l UTSW 5 134155809 missense probably benign
R4658:Rcc1l UTSW 5 134171890 missense probably damaging 1.00
R4791:Rcc1l UTSW 5 134163776 missense possibly damaging 0.89
R6076:Rcc1l UTSW 5 134169328 missense possibly damaging 0.90
R6291:Rcc1l UTSW 5 134166721 splice site probably null
R6508:Rcc1l UTSW 5 134169238 missense probably damaging 1.00
R6799:Rcc1l UTSW 5 134176713 start codon destroyed probably null
R7344:Rcc1l UTSW 5 134176437 missense probably benign 0.03
Z1177:Rcc1l UTSW 5 134163757 missense probably benign 0.10
Z1177:Rcc1l UTSW 5 134165408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCCATCCTTGACTGTGG -3'
(R):5'- CTGGGTCAGAAGAAGCTGTG -3'

Sequencing Primer
(F):5'- ATCCTTGACTGTGGCGCTCAG -3'
(R):5'- CCATCTGGGTGAGCAGAGTG -3'
Posted On2015-01-23