Incidental Mutation 'R3705:Gpnmb'
ID258702
Institutional Source Beutler Lab
Gene Symbol Gpnmb
Ensembl Gene ENSMUSG00000029816
Gene Nameglycoprotein (transmembrane) nmb
SynonymsOsteoactivin, Dchil
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49036546-49070929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49051865 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 439 (I439N)
Ref Sequence ENSEMBL: ENSMUSP00000145376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031840] [ENSMUST00000204260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031840
AA Change: I439N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031840
Gene: ENSMUSG00000029816
AA Change: I439N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 500 522 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204260
AA Change: I439N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816
AA Change: I439N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204460
Meta Mutation Damage Score 0.2485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit dispersed pigmentation of the iris, deterioration of the posterior iris epithelium and slit-like transillumination defects. The mutation contributes to glaucoma, especially in combination with the brown coat color mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Gpnmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Gpnmb APN 6 49055659 missense probably benign 0.01
IGL01291:Gpnmb APN 6 49055681 missense probably benign 0.12
IGL01307:Gpnmb APN 6 49045365 missense probably benign 0.03
IGL01398:Gpnmb APN 6 49050431 missense probably benign 0.02
IGL01531:Gpnmb APN 6 49047458 splice site probably benign
IGL01936:Gpnmb APN 6 49047450 missense probably null 1.00
ANU05:Gpnmb UTSW 6 49055681 missense probably benign 0.12
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0413:Gpnmb UTSW 6 49042803 missense probably benign
R0690:Gpnmb UTSW 6 49048015 missense probably benign 0.24
R0884:Gpnmb UTSW 6 49047913 missense possibly damaging 0.65
R1659:Gpnmb UTSW 6 49047852 missense probably damaging 1.00
R3703:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R4629:Gpnmb UTSW 6 49051060 missense possibly damaging 0.82
R4782:Gpnmb UTSW 6 49045483 splice site probably null
R4799:Gpnmb UTSW 6 49045483 splice site probably null
R4916:Gpnmb UTSW 6 49051970 missense probably damaging 1.00
R5223:Gpnmb UTSW 6 49056205 missense probably benign 0.01
R5390:Gpnmb UTSW 6 49047841 missense probably damaging 1.00
R5512:Gpnmb UTSW 6 49045464 missense possibly damaging 0.62
R5833:Gpnmb UTSW 6 49044018 missense probably damaging 1.00
R6103:Gpnmb UTSW 6 49042886 missense possibly damaging 0.86
R7211:Gpnmb UTSW 6 49052015 missense possibly damaging 0.82
R7900:Gpnmb UTSW 6 49050466 missense possibly damaging 0.83
R7983:Gpnmb UTSW 6 49050466 missense possibly damaging 0.83
Z1176:Gpnmb UTSW 6 49051832 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACCACGGCTGTATAGTGAGC -3'
(R):5'- TAAACAAACCTCACCTTTGCCAG -3'

Sequencing Primer
(F):5'- CTACATGGTAAGTTTGAAGCCGACC -3'
(R):5'- CCTTTGCCAGGGATAGAGATC -3'
Posted On2015-01-23