Incidental Mutation 'R3705:Cers3'
ID258705
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Nameceramide synthase 3
Synonymsrelated to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66743504-66823691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66786075 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 261 (A261S)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475] [ENSMUST00000208521]
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: A261S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: A261S

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208521
AA Change: A225S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66786003 splice site probably benign
IGL02832:Cers3 APN 7 66781825 missense probably benign 0.00
R0400:Cers3 UTSW 7 66764330 missense probably benign 0.03
R0490:Cers3 UTSW 7 66773690 missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66783418 missense probably damaging 1.00
R0571:Cers3 UTSW 7 66786057 missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66783404 missense probably damaging 1.00
R1538:Cers3 UTSW 7 66781823 missense probably damaging 0.98
R1767:Cers3 UTSW 7 66783403 missense probably damaging 1.00
R2155:Cers3 UTSW 7 66783414 missense probably damaging 0.99
R2427:Cers3 UTSW 7 66795793 missense probably benign 0.04
R3713:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3714:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3715:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3961:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3963:Cers3 UTSW 7 66786075 missense probably benign 0.25
R4238:Cers3 UTSW 7 66773676 missense probably damaging 1.00
R4652:Cers3 UTSW 7 66781856 splice site probably null
R5174:Cers3 UTSW 7 66784868 missense probably damaging 1.00
R6493:Cers3 UTSW 7 66743720 missense probably benign 0.07
R6675:Cers3 UTSW 7 66786096 missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66764220 missense probably damaging 1.00
R6833:Cers3 UTSW 7 66779671 critical splice donor site probably null
R7223:Cers3 UTSW 7 66783415 missense probably damaging 0.99
R7592:Cers3 UTSW 7 66789629 missense probably damaging 1.00
R7835:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R7918:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R8202:Cers3 UTSW 7 66786013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGTGTTAGGTGCTGTCTCAG -3'
(R):5'- GACAGAGTGCCCTTCCAAATC -3'

Sequencing Primer
(F):5'- TCAATAAGGGTGACACTTGCCCTG -3'
(R):5'- GAGTGCCCTTCCAAATCACTCAC -3'
Posted On2015-01-23