Incidental Mutation 'R3705:Tox3'
ID258709
Institutional Source Beutler Lab
Gene Symbol Tox3
Ensembl Gene ENSMUSG00000043668
Gene NameTOX high mobility group box family member 3
SynonymsCAGF9, Tnrc9, 500-9
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location90247040-90348343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90248905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 366 (T366K)
Ref Sequence ENSEMBL: ENSMUSP00000105250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109621] [ENSMUST00000176616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109621
AA Change: T366K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105250
Gene: ENSMUSG00000043668
AA Change: T366K

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
HMG 253 323 2.93e-19 SMART
low complexity region 345 362 N/A INTRINSIC
coiled coil region 438 466 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176616
SMART Domains Protein: ENSMUSP00000135697
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 194 213 N/A INTRINSIC
HMG 252 309 1.29e-6 SMART
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Tox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Tox3 APN 8 90270434 missense probably damaging 1.00
IGL02417:Tox3 APN 8 90258131 missense possibly damaging 0.52
IGL02447:Tox3 APN 8 90258153 splice site probably benign
R1139:Tox3 UTSW 8 90248869 missense probably damaging 1.00
R1472:Tox3 UTSW 8 90254345 missense probably damaging 1.00
R1892:Tox3 UTSW 8 90270241 missense probably benign 0.31
R1906:Tox3 UTSW 8 90248429 unclassified probably benign
R2847:Tox3 UTSW 8 90248390 nonsense probably null
R2849:Tox3 UTSW 8 90248390 nonsense probably null
R3703:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R4984:Tox3 UTSW 8 90248642 unclassified probably benign
R5249:Tox3 UTSW 8 90248816 missense probably benign 0.09
R5722:Tox3 UTSW 8 90347861 critical splice donor site probably null
R6291:Tox3 UTSW 8 90248938 missense probably damaging 1.00
R6451:Tox3 UTSW 8 90258059 missense probably benign 0.31
R7653:Tox3 UTSW 8 90248989 missense probably damaging 1.00
R7753:Tox3 UTSW 8 90248932 missense probably damaging 1.00
R8061:Tox3 UTSW 8 90248642 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCTGTAACTGCTGCTG -3'
(R):5'- TCGACAGTCCTATGGCAAAG -3'

Sequencing Primer
(F):5'- CTGCTGGGTTTGCACCGAAG -3'
(R):5'- CCTTGGAGATGGGGAAGCATG -3'
Posted On2015-01-23