Incidental Mutation 'R0326:Aire'
ID25871
Institutional Source Beutler Lab
Gene Symbol Aire
Ensembl Gene ENSMUSG00000000731
Gene Nameautoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
Synonyms
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78030022-78043610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78042599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 128 (R128S)
Ref Sequence ENSEMBL: ENSMUSP00000122190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000138785] [ENSMUST00000140636] [ENSMUST00000143735] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000154374] [ENSMUST00000155021] [ENSMUST00000156417]
Predicted Effect probably damaging
Transcript: ENSMUST00000019257
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 8.9e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
low complexity region 398 419 N/A INTRINSIC
PHD 432 475 7.82e-7 SMART
RING 433 474 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105395
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105396
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
PHD 373 416 7.82e-7 SMART
RING 374 415 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128241
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 5 104 3.3e-27 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
low complexity region 399 420 N/A INTRINSIC
PHD 433 476 7.82e-7 SMART
RING 434 475 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130972
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
low complexity region 394 415 N/A INTRINSIC
PHD 428 471 7.82e-7 SMART
RING 429 470 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131028
SMART Domains Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 5 57 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135316
Predicted Effect probably benign
Transcript: ENSMUST00000138785
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000140636
AA Change: R128S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143452
Predicted Effect possibly damaging
Transcript: ENSMUST00000143735
AA Change: R128S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.1e-34 PFAM
SAND 198 264 2.61e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145975
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
RING 297 338 3.63e0 SMART
low complexity region 395 416 N/A INTRINSIC
PHD 429 472 7.82e-7 SMART
RING 430 471 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148469
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154374
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 7.4e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
PHD 374 417 7.82e-7 SMART
RING 375 416 2.49e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155021
AA Change: R128S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
PHD 369 412 7.82e-7 SMART
RING 370 411 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156417
AA Change: R128S

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731
AA Change: R128S

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143548
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Aire
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Aire APN 10 78036723 nonsense probably null
IGL01969:Aire APN 10 78042982 missense probably damaging 1.00
BB008:Aire UTSW 10 78030296 missense probably damaging 1.00
BB018:Aire UTSW 10 78030296 missense probably damaging 1.00
E0370:Aire UTSW 10 78042063 missense probably damaging 1.00
IGL03055:Aire UTSW 10 78043069 missense probably damaging 1.00
R0675:Aire UTSW 10 78034493 splice site probably benign
R1748:Aire UTSW 10 78043480 missense probably damaging 0.99
R1754:Aire UTSW 10 78030290 missense probably damaging 1.00
R2014:Aire UTSW 10 78042958 missense probably damaging 1.00
R2015:Aire UTSW 10 78042958 missense probably damaging 1.00
R3800:Aire UTSW 10 78042055 splice site probably null
R5424:Aire UTSW 10 78036719 missense probably damaging 1.00
R5517:Aire UTSW 10 78039691 missense probably benign 0.14
R5983:Aire UTSW 10 78043069 missense probably damaging 1.00
R6135:Aire UTSW 10 78042967 missense probably damaging 1.00
R6856:Aire UTSW 10 78030255 missense probably damaging 1.00
R7405:Aire UTSW 10 78034613 missense probably benign 0.01
R7484:Aire UTSW 10 78042570 missense probably damaging 1.00
R7606:Aire UTSW 10 78037933 missense probably damaging 1.00
R7931:Aire UTSW 10 78030296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTTTGGGACAGTAAGACGC -3'
(R):5'- GCATCGGGGATATGGATACAAGTCG -3'

Sequencing Primer
(F):5'- CTCAGAGGTGACTCTGTGAC -3'
(R):5'- TTTTCAGGGAGCCACTAGAAC -3'
Posted On2013-04-16