Incidental Mutation 'R3705:Zfr2'
ID258714
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Namezinc finger RNA binding protein 2
Synonyms9130206N08Rik, 2010013I23Rik
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3705 (G1)
Quality Score120
Status Validated
Chromosome10
Chromosomal Location81233155-81252123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81246079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 493 (V493G)
Ref Sequence ENSEMBL: ENSMUSP00000113913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798]
Predicted Effect probably benign
Transcript: ENSMUST00000117798
AA Change: V493G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: V493G

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect probably benign
Transcript: ENSMUST00000137999
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0302:Zfr2 UTSW 10 81251336 unclassified probably benign
R0837:Zfr2 UTSW 10 81245408 missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4301:Zfr2 UTSW 10 81242184 unclassified probably benign
R4654:Zfr2 UTSW 10 81251249 splice site probably null
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCTGATGCCCCATGATC -3'
(R):5'- ATGCTATGCTGGACCCACAG -3'

Sequencing Primer
(F):5'- GATGCCCCATGATCCCTGAC -3'
(R):5'- ACAGCACTGGGTAGTCTCAG -3'
Posted On2015-01-23