Incidental Mutation 'R3705:9930111J21Rik1'
ID258718
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik1
Ensembl Gene ENSMUSG00000069893
Gene NameRIKEN cDNA 9930111J21 gene 1
Synonyms9930111J21Rik
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3705 (G1)
Quality Score199
Status Validated
Chromosome11
Chromosomal Location48946150-48979398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48947976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000095102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097494
AA Change: T595A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893
AA Change: T595A

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Meta Mutation Damage Score 0.5383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in 9930111J21Rik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:9930111J21Rik1 APN 11 48948212 missense possibly damaging 0.66
IGL02189:9930111J21Rik1 APN 11 48947421 missense probably benign 0.09
IGL02554:9930111J21Rik1 APN 11 48948003 missense probably damaging 1.00
IGL03172:9930111J21Rik1 APN 11 48948176 missense probably damaging 1.00
IGL03334:9930111J21Rik1 APN 11 48947475 missense probably benign 0.09
R0502:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R0503:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R2023:9930111J21Rik1 UTSW 11 48948420 missense possibly damaging 0.51
R3704:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3714:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3715:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3961:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3962:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R4867:9930111J21Rik1 UTSW 11 48948548 critical splice acceptor site probably null
R5033:9930111J21Rik1 UTSW 11 48947706 missense probably damaging 1.00
R5159:9930111J21Rik1 UTSW 11 48948525 missense probably benign 0.06
R6567:9930111J21Rik1 UTSW 11 48948123 missense probably benign 0.26
R6774:9930111J21Rik1 UTSW 11 48947316 missense possibly damaging 0.94
R7730:9930111J21Rik1 UTSW 11 48947876 missense probably benign 0.19
R7863:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
R7946:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
X0067:9930111J21Rik1 UTSW 11 48948042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGAGGTGGCGCTTG -3'
(R):5'- ACAATATGGGATTTGCCTGGC -3'

Sequencing Primer
(F):5'- CTCAGTAGGGTGGTCTCCAG -3'
(R):5'- GCCTGGCATTGGGTCTACTAC -3'
Posted On2015-01-23