Mutagenetix > Incidental Mutations

Incidental Mutation 'R3705:Nmur2'

258719

Institutional Source

Beutler Lab

Gene Symbol

Nmur2

Ensembl Gene

ENSMUSG00000037393

Gene Name

neuromedin U receptor 2

Synonyms

MMRRC Submission

040698-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R3705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56024987-56041010 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56040474 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 137 (Y137C)

Ref Sequence

ENSEMBL: ENSMUSP00000044718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037682]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037682
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: Y137C

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srw	42	337	4.7e-7	PFAM
Pfam:7TM_GPCR_Srsx	48	334	1.8e-13	PFAM
Pfam:7tm_1	54	319	5.7e-51	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134285

Meta Mutation Damage Score

0.9657

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,987,581	C2703S	probably damaging	Het
9930111J21Rik1	T	C	11: 48,947,976	T595A	possibly damaging	Het
Abca12	T	C	1: 71,285,705	D1538G	probably damaging	Het
Asap3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGAGGAGGA	4: 136,241,241		probably benign	Het
Bcap29	T	C	12: 31,617,152	H170R	probably benign	Het
Brwd3	A	G	X: 108,760,415		probably benign	Het
Capn1	T	C	19: 6,007,371	E349G	probably damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Csf3r	A	G	4: 126,032,285	D221G	possibly damaging	Het
Cubn	T	A	2: 13,350,943	H1826L	probably damaging	Het
Dnajc19	A	G	3: 34,080,229		probably null	Het
Dync1h1	G	A	12: 110,640,586	V2566I	possibly damaging	Het
Ehd1	A	G	19: 6,298,300	D436G	probably benign	Het
Fam133b	T	C	5: 3,561,034		probably benign	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Gm13084	T	C	4: 143,811,775	T209A	probably benign	Het
Gpnmb	T	A	6: 49,051,865	I439N	possibly damaging	Het
Grm1	G	A	10: 10,782,729	T339I	possibly damaging	Het
Gtpbp3	T	G	8: 71,492,135	S345A	probably benign	Het
Hdac4	A	G	1: 91,934,694		probably benign	Het
Hfm1	A	G	5: 106,892,839		probably benign	Het
Ift172	A	G	5: 31,261,437		probably null	Het
Igfn1	T	C	1: 135,968,409	N1473S	probably benign	Het
Jak3	A	G	8: 71,681,522	K423E	probably damaging	Het
Kifc3	G	A	8: 95,104,028		probably benign	Het
Lrrc8d	T	C	5: 105,813,475	S584P	probably damaging	Het
Nipal4	T	C	11: 46,161,851		probably benign	Het
Nisch	A	G	14: 31,176,745		probably benign	Het
Nod2	T	C	8: 88,653,320	S150P	probably benign	Het
Olfr153	A	G	2: 87,532,068	I12V	probably benign	Het
Pdgfc	T	C	3: 81,204,444		probably null	Het
Phldb1	G	T	9: 44,694,394	H1323N	probably damaging	Het
Ppp1r14c	A	G	10: 3,423,524	I112V	possibly damaging	Het
Rcc1l	A	T	5: 134,154,191	V414E	probably damaging	Het
Riok3	A	G	18: 12,148,954	M327V	probably benign	Het
Sf3b4	T	C	3: 96,176,628		probably benign	Het
Spag6	A	G	2: 18,710,557	Y49C	probably damaging	Het
Syngap1	T	C	17: 26,960,020	S495P	probably damaging	Het
Tedc2	A	G	17: 24,216,387	S343P	probably benign	Het
Tenm2	T	A	11: 36,068,326	D1132V	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Top1	G	A	2: 160,702,824		probably null	Het
Tox3	G	T	8: 90,248,905	T366K	possibly damaging	Het
Tph2	G	A	10: 115,119,893	Q332*	probably null	Het
Zfr2	T	G	10: 81,246,079	V493G	probably benign	Het

Other mutations in Nmur2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nmur2	APN	11	56040777	missense	probably damaging	0.99
IGL01591:Nmur2	APN	11	56026999	missense	probably benign
IGL01960:Nmur2	APN	11	56040511	missense	probably damaging	0.99
IGL02108:Nmur2	APN	11	56040364	missense	probably benign	0.33
IGL02602:Nmur2	APN	11	56027063	missense	probably benign	0.19
PIT4677001:Nmur2	UTSW	11	56033009	missense	probably benign	0.00
R0324:Nmur2	UTSW	11	56040520	missense	probably damaging	1.00
R0458:Nmur2	UTSW	11	56040568	missense	possibly damaging	0.93
R0718:Nmur2	UTSW	11	56029498	splice site	probably benign
R1799:Nmur2	UTSW	11	56029621	missense	probably damaging	1.00
R2099:Nmur2	UTSW	11	56040763	missense	probably benign	0.00
R2263:Nmur2	UTSW	11	56029561	missense	probably damaging	0.97
R3701:Nmur2	UTSW	11	56040777	missense	probably damaging	0.99
R3951:Nmur2	UTSW	11	56040225	missense	probably damaging	1.00
R4083:Nmur2	UTSW	11	56040225	missense	probably damaging	1.00
R4744:Nmur2	UTSW	11	56040835	missense	probably benign	0.01
R4747:Nmur2	UTSW	11	56040279	missense	probably benign	0.05
R5288:Nmur2	UTSW	11	56040214	missense	probably damaging	1.00
R5384:Nmur2	UTSW	11	56040214	missense	probably damaging	1.00
R5579:Nmur2	UTSW	11	56033009	missense	probably benign	0.00
R6329:Nmur2	UTSW	11	56029585	missense	probably benign	0.30
R6477:Nmur2	UTSW	11	56029591	missense	probably damaging	1.00
R7445:Nmur2	UTSW	11	56032940	missense	probably damaging	0.97
R7580:Nmur2	UTSW	11	56026982	missense	probably benign	0.03
R7899:Nmur2	UTSW	11	56040335	missense	probably benign
R8688:Nmur2	UTSW	11	56040828	missense	probably damaging	1.00
X0062:Nmur2	UTSW	11	56040849	missense	probably benign	0.01
Z1176:Nmur2	UTSW	11	56027101	missense	probably benign	0.12
Z1186:Nmur2	UTSW	11	56040278	missense	probably benign
Z1187:Nmur2	UTSW	11	56040278	missense	probably benign
Z1188:Nmur2	UTSW	11	56040278	missense	probably benign
Z1189:Nmur2	UTSW	11	56040278	missense	probably benign
Z1190:Nmur2	UTSW	11	56040278	missense	probably benign
Z1191:Nmur2	UTSW	11	56040278	missense	probably benign
Z1192:Nmur2	UTSW	11	56040278	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTGGATGATGAAGTTATACACCC -3'
(R):5'- TCAGCTTGGCAGTCTCAGAC -3'

Sequencing Primer
(F):5'- GATGATGAAGTTATACACCCATATGG -3'
(R):5'- GCAGTCTCAGACTTGCTGGTC -3'

Posted On

2015-01-23