Incidental Mutation 'R3705:Riok3'
ID258726
Institutional Source Beutler Lab
Gene Symbol Riok3
Ensembl Gene ENSMUSG00000024404
Gene NameRIO kinase 3
SynonymsSudd, 1200013N13Rik, E130306C24Rik, D18Ertd331e
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12128850-12157367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12148954 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 327 (M327V)
Ref Sequence ENSEMBL: ENSMUSP00000025270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025270]
Predicted Effect probably benign
Transcript: ENSMUST00000025270
AA Change: M327V

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025270
Gene: ENSMUSG00000024404
AA Change: M327V

DomainStartEndE-ValueType
low complexity region 41 63 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
RIO 222 470 9.88e-141 SMART
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified by the similarity of its product to the Aspergillus nidulans SUDD protein. This gene is now recognized as a member of the right open reading frame (RIO) kinase gene family. This gene encodes a serine/threonine kinase that localizes to the cytoplasm and plays a role in the processing of the pre-40 S ribosomal subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Riok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Riok3 APN 18 12148891 missense possibly damaging 0.81
IGL00229:Riok3 APN 18 12137020 missense probably damaging 1.00
IGL00434:Riok3 APN 18 12148847 missense probably damaging 1.00
IGL01348:Riok3 APN 18 12152963 splice site probably benign
IGL01886:Riok3 APN 18 12139385 missense probably damaging 1.00
IGL02553:Riok3 APN 18 12143016 nonsense probably null
IGL02622:Riok3 APN 18 12142960 missense probably benign 0.24
IGL02718:Riok3 APN 18 12152996 nonsense probably null
LCD18:Riok3 UTSW 18 12129982 intron probably benign
R0240:Riok3 UTSW 18 12155227 missense probably benign 0.37
R0359:Riok3 UTSW 18 12148949 missense probably damaging 1.00
R1505:Riok3 UTSW 18 12152878 missense probably benign 0.06
R1519:Riok3 UTSW 18 12137306 missense probably damaging 1.00
R1698:Riok3 UTSW 18 12128929 missense probably benign 0.02
R1710:Riok3 UTSW 18 12142961 missense probably benign 0.24
R1965:Riok3 UTSW 18 12136962 missense probably damaging 0.99
R2351:Riok3 UTSW 18 12149667 nonsense probably null
R3914:Riok3 UTSW 18 12148822 missense probably benign
R3956:Riok3 UTSW 18 12142974 nonsense probably null
R4272:Riok3 UTSW 18 12135941 small deletion probably benign
R4273:Riok3 UTSW 18 12135941 small deletion probably benign
R4564:Riok3 UTSW 18 12148879 missense probably damaging 0.99
R4589:Riok3 UTSW 18 12136787 missense probably benign 0.06
R4729:Riok3 UTSW 18 12128927 missense possibly damaging 0.82
R4751:Riok3 UTSW 18 12153983 missense probably benign 0.00
R4938:Riok3 UTSW 18 12155243 missense probably benign 0.06
R4945:Riok3 UTSW 18 12128915 missense probably damaging 0.96
R5449:Riok3 UTSW 18 12155246 missense probably damaging 0.97
R5928:Riok3 UTSW 18 12153018 missense probably benign 0.16
R6220:Riok3 UTSW 18 12149551 missense probably damaging 0.97
R7962:Riok3 UTSW 18 12136719 missense probably benign
R8422:Riok3 UTSW 18 12136812 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTTAGCCTGGAGGATG -3'
(R):5'- TCCCTTAAATGTCAGTGAAGAAGG -3'

Sequencing Primer
(F):5'- TCCCTTTAGCCTGGAGGATGAAAAG -3'
(R):5'- AGGACTTCTGGTTCTAAACATGG -3'
Posted On2015-01-23