Incidental Mutation 'R3707:Olfr1145'
ID258737
Institutional Source Beutler Lab
Gene Symbol Olfr1145
Ensembl Gene ENSMUSG00000068814
Gene Nameolfactory receptor 1145
SynonymsGA_x6K02T2Q125-49311440-49312384, MOR264-19
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87809822-87810799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87810176 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 119 (C119R)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
Predicted Effect probably damaging
Transcript: ENSMUST00000079711
AA Change: C108R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: C108R

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090707
AA Change: C119R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: C119R

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118227
Meta Mutation Damage Score 0.5597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Olfr1145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr1145 APN 2 87810648 missense probably damaging 1.00
IGL01335:Olfr1145 APN 2 87810446 missense probably damaging 1.00
PIT4418001:Olfr1145 UTSW 2 87810594 missense probably damaging 0.99
R1512:Olfr1145 UTSW 2 87810644 missense probably benign 0.23
R1700:Olfr1145 UTSW 2 87810768 missense probably benign
R2127:Olfr1145 UTSW 2 87810341 missense probably benign 0.09
R2162:Olfr1145 UTSW 2 87810360 missense probably damaging 1.00
R4327:Olfr1145 UTSW 2 87810152 missense probably benign 0.00
R4422:Olfr1145 UTSW 2 87810645 missense probably damaging 0.97
R4854:Olfr1145 UTSW 2 87810590 missense probably damaging 1.00
R5234:Olfr1145 UTSW 2 87810768 missense probably benign
R5858:Olfr1145 UTSW 2 87810641 missense probably benign 0.22
R6229:Olfr1145 UTSW 2 87810087 missense probably damaging 1.00
R6991:Olfr1145 UTSW 2 87810443 missense possibly damaging 0.76
R7007:Olfr1145 UTSW 2 87809886 missense probably damaging 1.00
R7027:Olfr1145 UTSW 2 87810716 missense possibly damaging 0.90
R7260:Olfr1145 UTSW 2 87810387 missense probably damaging 0.98
R7624:Olfr1145 UTSW 2 87810339 missense probably damaging 1.00
R7794:Olfr1145 UTSW 2 87810474 missense probably damaging 0.97
R8029:Olfr1145 UTSW 2 87810032 missense probably benign 0.00
Z1088:Olfr1145 UTSW 2 87810746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGTTCTCCATCATTTACAGG -3'
(R):5'- CCAACAGGTTTGTCCAATCTG -3'

Sequencing Primer
(F):5'- GGATTATCCTCACTGGCAATTG -3'
(R):5'- CTGAATTGGAATGCCACTTAGCCAG -3'
Posted On2015-01-23