Incidental Mutation 'R3707:Vmn2r4'
ID258742
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64389474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 630 (I630N)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably damaging
Transcript: ENSMUST00000170280
AA Change: I541N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: I541N

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: I630N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: I630N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAAGCCCAGTGCCAGAGTG -3'
(R):5'- GATCTTTAACTGAACCAGACTGTTC -3'

Sequencing Primer
(F):5'- AGTGCCAGAGTGACCTGAC -3'
(R):5'- CCAGACTGTTCATAGTTAAATGTGAC -3'
Posted On2015-01-23