Incidental Mutation 'R3707:Nkain3'
ID258743
Institutional Source Beutler Lab
Gene Symbol Nkain3
Ensembl Gene ENSMUSG00000055761
Gene NameNa+/K+ transporting ATPase interacting 3
Synonyms
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location20118874-20778866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20484920 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 52 (F52L)
Ref Sequence ENSEMBL: ENSMUSP00000113113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102998] [ENSMUST00000119374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102998
AA Change: F52L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100063
Gene: ENSMUSG00000055761
AA Change: F52L

DomainStartEndE-ValueType
Pfam:NKAIN 1 162 1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119374
AA Change: F52L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113113
Gene: ENSMUSG00000055761
AA Change: F52L

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 7e-83 PFAM
Meta Mutation Damage Score 0.7907 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN3 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Nkain3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02610:Nkain3 APN 4 20469459 missense probably damaging 1.00
I1329:Nkain3 UTSW 4 20158329 splice site probably benign
IGL03055:Nkain3 UTSW 4 20778308 missense probably benign 0.01
R0726:Nkain3 UTSW 4 20158388 missense possibly damaging 0.67
R1485:Nkain3 UTSW 4 20484932 missense probably damaging 1.00
R1600:Nkain3 UTSW 4 20469528 splice site probably benign
R1702:Nkain3 UTSW 4 20158339 critical splice donor site probably null
R4192:Nkain3 UTSW 4 20485003 nonsense probably null
R4392:Nkain3 UTSW 4 20282985 missense possibly damaging 0.89
R4410:Nkain3 UTSW 4 20778284 missense probably benign 0.20
R4721:Nkain3 UTSW 4 20485015 missense probably damaging 0.98
R5333:Nkain3 UTSW 4 20484889 missense probably benign 0.04
R5978:Nkain3 UTSW 4 20485026 splice site probably null
R7208:Nkain3 UTSW 4 20282892 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAGCCCTAGATTAGCGGTATG -3'
(R):5'- AGATTTCTGCAGCTGGGAGC -3'

Sequencing Primer
(F):5'- CGGTATGCTAGCGGTGTAAG -3'
(R):5'- GCTGGGAGCTAATGATGAAGATG -3'
Posted On2015-01-23