Incidental Mutation 'R3707:Zbtb40'
ID258745
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136999568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 486 (Y486H)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably damaging
Transcript: ENSMUST00000049583
AA Change: Y486H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: Y486H

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Meta Mutation Damage Score 0.3381 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R4131:Zbtb40 UTSW 4 136995396 missense probably benign 0.00
R4243:Zbtb40 UTSW 4 137018549 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4838:Zbtb40 UTSW 4 137001216 missense probably benign 0.15
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5536:Zbtb40 UTSW 4 136987331 missense probably damaging 1.00
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6114:Zbtb40 UTSW 4 136988691 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Z1176:Zbtb40 UTSW 4 136995463 missense probably damaging 1.00
Z1177:Zbtb40 UTSW 4 137018024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATTTCCCAACATAGCTGTG -3'
(R):5'- GAGGAGATCTGAACCCTGTG -3'

Sequencing Primer
(F):5'- CATTTCCCAACATAGCTGTGTATATG -3'
(R):5'- AGATCTGAACCCTGTGTGTGCAG -3'
Posted On2015-01-23