Incidental Mutation 'R3707:Tapbpl'
ID258746
Institutional Source Beutler Lab
Gene Symbol Tapbpl
Ensembl Gene ENSMUSG00000038213
Gene NameTAP binding protein-like
SynonymsTAPBPL-R
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125223933-125231860 bp(-) (GRCm38)
Type of Mutationunclassified (3043 bp from exon)
DNA Base Change (assembly) A to G at 125224695 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032487] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000100942]
Predicted Effect probably null
Transcript: ENSMUST00000032487
SMART Domains Protein: ENSMUSP00000032487
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043422
AA Change: S443P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213
AA Change: S443P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100942
SMART Domains Protein: ENSMUSP00000098503
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 116 1.9e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205223
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Tapbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03083:Tapbpl APN 6 125228228 unclassified probably null
IGL03308:Tapbpl APN 6 125228179 missense possibly damaging 0.93
R1666:Tapbpl UTSW 6 125230201 missense probably benign 0.00
R4521:Tapbpl UTSW 6 125228122 missense probably damaging 1.00
R4744:Tapbpl UTSW 6 125228285 missense probably damaging 1.00
R6290:Tapbpl UTSW 6 125230716 missense probably benign 0.00
R6328:Tapbpl UTSW 6 125224918 missense probably benign 0.40
R6565:Tapbpl UTSW 6 125228344 missense probably benign 0.00
R7085:Tapbpl UTSW 6 125226488 splice site probably null
R7251:Tapbpl UTSW 6 125226595 missense probably damaging 0.98
X0026:Tapbpl UTSW 6 125230570 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGGGCTCTCTTCTCAATAGC -3'
(R):5'- TGGGAGTCATCTTTGCCAGC -3'

Sequencing Primer
(F):5'- GGCTCTCTTCTCAATAGCACAGAAAG -3'
(R):5'- CTTCACAGACAGCAAGGTGAGTTTG -3'
Posted On2015-01-23