Incidental Mutation 'R3707:Mtg1'
ID258751
Institutional Source Beutler Lab
Gene Symbol Mtg1
Ensembl Gene ENSMUSG00000039018
Gene Namemitochondrial ribosome-associated GTPase 1
SynonymsGtpbp7, LOC212508
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140137564-140150786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140149804 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 269 (K269M)
Ref Sequence ENSEMBL: ENSMUSP00000036491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036977] [ENSMUST00000059241]
Predicted Effect probably damaging
Transcript: ENSMUST00000036977
AA Change: K269M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018
AA Change: K269M

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059241
SMART Domains Protein: ENSMUSP00000053901
Gene: ENSMUSG00000045733

DomainStartEndE-ValueType
Pfam:Shadoo 19 147 7.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155723
Predicted Effect probably benign
Transcript: ENSMUST00000156791
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Mtg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Mtg1 APN 7 140150236 missense probably benign 0.00
IGL02105:Mtg1 APN 7 140150206 missense probably damaging 1.00
IGL02458:Mtg1 APN 7 140150172 missense probably benign 0.01
IGL02682:Mtg1 APN 7 140144729 splice site probably benign
R0666:Mtg1 UTSW 7 140144344 missense probably benign
R0893:Mtg1 UTSW 7 140149752 missense probably damaging 1.00
R4993:Mtg1 UTSW 7 140140283 missense probably null 1.00
R5810:Mtg1 UTSW 7 140145985 splice site probably null
R5886:Mtg1 UTSW 7 140149865 splice site probably null
R5960:Mtg1 UTSW 7 140146993 unclassified probably benign
R7069:Mtg1 UTSW 7 140143744 missense probably benign 0.00
R7110:Mtg1 UTSW 7 140146866 missense probably benign 0.02
R7492:Mtg1 UTSW 7 140144697 missense probably damaging 1.00
R7790:Mtg1 UTSW 7 140149749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTACTGTCTTGGTGAGGGA -3'
(R):5'- GTCCTTCCACCCTAGAAACTTCC -3'

Sequencing Primer
(F):5'- GTTCTAGAGCACTAAATTGCCTGG -3'
(R):5'- GAAACTTCCACAGTGTCCTGC -3'
Posted On2015-01-23