Incidental Mutation 'R3707:Avpr1a'
ID258754
Institutional Source Beutler Lab
Gene Symbol Avpr1a
Ensembl Gene ENSMUSG00000020123
Gene Namearginine vasopressin receptor 1A
SynonymsV1aR
MMRRC Submission 040700-MU
Accession Numbers

Genbank: NM_016847; MGI: 1859216

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location122448499-122453452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122449109 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 102 (F102Y)
Ref Sequence ENSEMBL: ENSMUSP00000020323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020323]
Predicted Effect probably damaging
Transcript: ENSMUST00000020323
AA Change: F102Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020323
Gene: ENSMUSG00000020123
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:7tm_4 58 206 8.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 62 362 6.1e-10 PFAM
Pfam:7tm_1 68 353 4.5e-49 PFAM
Pfam:7TM_GPCR_Srv 98 370 1.5e-10 PFAM
DUF1856 377 423 2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218285
Meta Mutation Damage Score 0.3673 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a receptor for arginine vasopressin, a neurohypophyseal hormone involved in diuresis inhibition, smooth muscle contraction, liver glycogenolysis stimulation and regulation of adrenocorticotropic hormone release from the pituitary. This receptor represents one of three G protein-coupled arginine vasopressin receptors which functions through a phosphotidylinositol-calcium second messenger system in vascular and hepatic tissues [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a stimulus processing deficit similar to that seen in schizophrenia. Anxiety-like behaviors are reduced in males but not females. B cell development is also affected. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Avpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Avpr1a APN 10 122449351 missense probably benign
IGL01062:Avpr1a APN 10 122449529 missense probably damaging 0.99
IGL01317:Avpr1a APN 10 122449567 missense probably benign
IGL01813:Avpr1a APN 10 122449011 missense probably damaging 1.00
IGL01947:Avpr1a APN 10 122452182 missense probably benign 0.00
IGL02549:Avpr1a APN 10 122452164 missense possibly damaging 0.91
IGL02967:Avpr1a APN 10 122449462 missense possibly damaging 0.95
IGL03114:Avpr1a APN 10 122449718 missense probably damaging 0.99
H8786:Avpr1a UTSW 10 122449468 missense probably benign 0.01
R0211:Avpr1a UTSW 10 122449469 missense possibly damaging 0.54
R0268:Avpr1a UTSW 10 122449709 missense probably damaging 1.00
R1188:Avpr1a UTSW 10 122448919 missense possibly damaging 0.85
R1909:Avpr1a UTSW 10 122452208 missense probably benign
R1935:Avpr1a UTSW 10 122449790 critical splice donor site probably null
R2404:Avpr1a UTSW 10 122449210 missense possibly damaging 0.78
R3927:Avpr1a UTSW 10 122449711 missense probably benign 0.00
R4722:Avpr1a UTSW 10 122449001 missense possibly damaging 0.62
R4952:Avpr1a UTSW 10 122449754 missense probably damaging 0.98
R5384:Avpr1a UTSW 10 122449369 missense probably damaging 1.00
R5807:Avpr1a UTSW 10 122449471 missense probably benign 0.14
R6024:Avpr1a UTSW 10 122449148 missense probably damaging 0.99
R7043:Avpr1a UTSW 10 122449681 missense probably damaging 1.00
R7359:Avpr1a UTSW 10 122449378 missense possibly damaging 0.70
R7455:Avpr1a UTSW 10 122449264 missense probably damaging 1.00
Z1088:Avpr1a UTSW 10 122449577 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTTAGGACGCGGGTCTTC -3'
(R):5'- TGGTATGCTCAGAACGAAACTC -3'

Sequencing Primer
(F):5'- ACAGCATGAGTTTCCCGC -3'
(R):5'- CTGCTGCAGGGTCTTGAGC -3'
Posted On2015-01-23