Incidental Mutation 'R3707:Olfr767'
ID 258755
Institutional Source Beutler Lab
Gene Symbol Olfr767
Ensembl Gene ENSMUSG00000059762
Gene Name olfactory receptor 767
Synonyms MOR115-1, GA_x6K02T2PULF-10765431-10764502
MMRRC Submission 040700-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3707 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129074825-129082910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129079385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000150151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082131] [ENSMUST00000213579]
AlphaFold Q8VG33
Predicted Effect probably benign
Transcript: ENSMUST00000082131
AA Change: I193F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080775
Gene: ENSMUSG00000059762
AA Change: I193F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.9e-49 PFAM
Pfam:7tm_1 39 288 3.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213579
AA Change: I193F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Olfr767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Olfr767 APN 10 129079355 missense probably benign 0.13
IGL01945:Olfr767 APN 10 129079303 missense probably damaging 1.00
IGL02341:Olfr767 APN 10 129079461 nonsense probably null
IGL02389:Olfr767 APN 10 129079230 missense probably damaging 0.97
IGL02516:Olfr767 APN 10 129079793 missense possibly damaging 0.95
IGL02755:Olfr767 APN 10 129079196 missense probably benign 0.00
R0145:Olfr767 UTSW 10 129079363 missense probably damaging 0.97
R0453:Olfr767 UTSW 10 129079771 missense probably damaging 0.97
R0578:Olfr767 UTSW 10 129079193 missense probably damaging 1.00
R1034:Olfr767 UTSW 10 129079961 start codon destroyed probably benign 0.43
R1494:Olfr767 UTSW 10 129079615 missense probably damaging 1.00
R1941:Olfr767 UTSW 10 129079954 missense probably damaging 0.99
R5405:Olfr767 UTSW 10 129079396 missense probably damaging 0.99
R5716:Olfr767 UTSW 10 129079555 missense probably benign 0.00
R8224:Olfr767 UTSW 10 129079435 missense possibly damaging 0.90
R9680:Olfr767 UTSW 10 129079489 missense probably benign 0.02
Z1177:Olfr767 UTSW 10 129080052 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCTCCCATAAGAGAGG -3'
(R):5'- TATGTGGCCATATGCAAACCC -3'

Sequencing Primer
(F):5'- CTCCCATAAGAGAGGGAGATGAC -3'
(R):5'- GCAATCATGAGCAACAGAGTCTGTAC -3'
Posted On 2015-01-23