Incidental Mutation 'R3707:Pdhb'
ID258760
Institutional Source Beutler Lab
Gene Symbol Pdhb
Ensembl Gene ENSMUSG00000021748
Gene Namepyruvate dehydrogenase (lipoamide) beta
Synonyms
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8165996-8173025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8170409 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 114 (N114S)
Ref Sequence ENSEMBL: ENSMUSP00000022268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022268]
Predicted Effect probably damaging
Transcript: ENSMUST00000022268
AA Change: N114S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022268
Gene: ENSMUSG00000021748
AA Change: N114S

DomainStartEndE-ValueType
Transket_pyr 33 208 3.62e-58 SMART
Pfam:Transketolase_C 226 349 2.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225747
Meta Mutation Damage Score 0.7971 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and carbon dioxide, and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 beta subunit. Mutations in this gene are associated with pyruvate dehydrogenase E1-beta deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Pdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03018:Pdhb APN 14 8171537 splice site probably benign
PIT1430001:Pdhb UTSW 14 8170425 missense probably damaging 1.00
R0426:Pdhb UTSW 14 8169801 missense probably damaging 1.00
R1019:Pdhb UTSW 14 8171442 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAATTCCAGGGGCTGACC -3'
(R):5'- GAGCTAATCCAAGGAGGTTTCC -3'

Sequencing Primer
(F):5'- GACCACTTTTAAACCTGGGCAGTG -3'
(R):5'- TGTATGTCGGGAGAGTAGAC -3'
Posted On2015-01-23