Incidental Mutation 'R3707:Top2b'
ID 258761
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 040700-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R3707 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16388447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: V188A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: V188A

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159987
Meta Mutation Damage Score 0.8560 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Avpr1a T A 10: 122,285,014 (GRCm39) F102Y probably damaging Het
Bcs1l A G 1: 74,629,264 (GRCm39) probably benign Het
Chrng C T 1: 87,138,333 (GRCm39) Q375* probably null Het
Cplane1 T C 15: 8,289,300 (GRCm39) S2917P unknown Het
Cyp2d10 A G 15: 82,287,217 (GRCm39) F469L possibly damaging Het
Dennd6a T C 14: 26,313,546 (GRCm39) probably benign Het
Eef2k C A 7: 120,483,935 (GRCm39) L224I probably damaging Het
Gm10033 G C 8: 69,825,068 (GRCm39) noncoding transcript Het
Gm11545 T C 11: 94,648,385 (GRCm39) noncoding transcript Het
Herpud1 T A 8: 95,118,867 (GRCm39) V207D probably damaging Het
Hmbox1 T C 14: 65,134,285 (GRCm39) Y105C probably benign Het
Ighv1-85 A T 12: 115,963,836 (GRCm39) W55R probably damaging Het
Lgr4 T C 2: 109,801,099 (GRCm39) L83P probably damaging Het
Lrch1 C T 14: 75,095,437 (GRCm39) M134I probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mtg1 A T 7: 139,729,717 (GRCm39) K269M probably damaging Het
Nkain3 A T 4: 20,484,920 (GRCm39) F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 (GRCm39) Y417F probably damaging Het
Or12e10 T C 2: 87,640,520 (GRCm39) C119R probably damaging Het
Or6c8 T A 10: 128,915,254 (GRCm39) I193F probably benign Het
Pappa2 A T 1: 158,662,488 (GRCm39) Y1162* probably null Het
Pdhb T C 14: 8,170,409 (GRCm38) N114S probably damaging Het
Pigc T A 1: 161,798,663 (GRCm39) M215K probably benign Het
Pimreg G A 11: 71,937,158 (GRCm39) probably benign Het
Ppfia4 T C 1: 134,237,398 (GRCm39) E967G probably damaging Het
Resf1 C T 6: 149,230,611 (GRCm39) S1219L probably damaging Het
Rif1 T A 2: 51,983,592 (GRCm39) D578E probably damaging Het
Rrbp1 G T 2: 143,795,197 (GRCm39) A1269E probably benign Het
Rufy3 G A 5: 88,790,891 (GRCm39) A531T probably benign Het
Slc22a22 C A 15: 57,114,369 (GRCm39) L319F probably damaging Het
Tapbpl A G 6: 125,201,658 (GRCm39) probably null Het
Tdrd1 T C 19: 56,854,425 (GRCm39) S1124P possibly damaging Het
Top2a T C 11: 98,887,651 (GRCm39) K1286E probably benign Het
Vmn2r4 A T 3: 64,296,895 (GRCm39) I630N probably damaging Het
Vmn2r53 T C 7: 12,315,981 (GRCm39) T613A possibly damaging Het
Zbtb40 A G 4: 136,726,879 (GRCm39) Y486H probably damaging Het
Zfp715 T C 7: 42,960,553 (GRCm39) T13A probably benign Het
Zfx A G X: 93,142,413 (GRCm39) V36A possibly damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATTCAGCCAGGACTTGAGAG -3'
(R):5'- AACTGTATATGCCCCAGTACAG -3'

Sequencing Primer
(F):5'- TCAGCCAGGACTTGAGAGAATGATAC -3'
(R):5'- CCAGTACAGGGAACGCCAG -3'
Posted On 2015-01-23