Incidental Mutation 'R3707:Lrch1'
ID258764
Institutional Source Beutler Lab
Gene Symbol Lrch1
Ensembl Gene ENSMUSG00000068015
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms4832412D13Rik, Chdc1
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74754675-74947876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74857997 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 134 (M134I)
Ref Sequence ENSEMBL: ENSMUSP00000154004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088970] [ENSMUST00000228252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088970
AA Change: M134I

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086363
Gene: ENSMUSG00000068015
AA Change: M134I

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
LRR 109 131 1.86e1 SMART
LRR_TYP 132 155 3.39e-3 SMART
LRR 177 199 1.41e1 SMART
LRR 200 223 4.34e-1 SMART
LRR 245 268 1.66e1 SMART
low complexity region 306 322 N/A INTRINSIC
CH 591 698 1.71e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228134
Predicted Effect probably damaging
Transcript: ENSMUST00000228252
AA Change: M134I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous knockout leads to increased susceptibility to experimental autoimmune encephalomyelitis as a result of increased migration of T cells into the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Lrch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Lrch1 APN 14 74757063 missense probably benign 0.22
IGL01137:Lrch1 APN 14 74757092 missense probably damaging 0.98
IGL01978:Lrch1 APN 14 74786342 missense probably damaging 1.00
IGL01988:Lrch1 APN 14 74795373 splice site probably benign
IGL02036:Lrch1 APN 14 74795293 splice site probably benign
IGL02650:Lrch1 APN 14 74813698 missense probably damaging 1.00
IGL03006:Lrch1 APN 14 74813620 missense probably damaging 0.99
IGL03106:Lrch1 APN 14 74835762 missense possibly damaging 0.84
IGL03353:Lrch1 APN 14 74858042 missense probably damaging 1.00
FR4304:Lrch1 UTSW 14 74819565 missense possibly damaging 0.81
LCD18:Lrch1 UTSW 14 74905021 intron probably benign
R0129:Lrch1 UTSW 14 74835746 missense probably benign 0.13
R0312:Lrch1 UTSW 14 74947594 missense possibly damaging 0.82
R0441:Lrch1 UTSW 14 74947545 missense possibly damaging 0.95
R0622:Lrch1 UTSW 14 74796051 missense probably benign 0.00
R1418:Lrch1 UTSW 14 74804269 splice site probably benign
R1618:Lrch1 UTSW 14 74813704 missense probably damaging 1.00
R2116:Lrch1 UTSW 14 74785531 missense probably damaging 1.00
R2428:Lrch1 UTSW 14 74807545 splice site probably benign
R4352:Lrch1 UTSW 14 74818578 missense probably damaging 0.98
R5689:Lrch1 UTSW 14 74786324 missense probably damaging 1.00
R5754:Lrch1 UTSW 14 74817118 missense probably damaging 1.00
R6142:Lrch1 UTSW 14 74947500 missense probably damaging 1.00
R6469:Lrch1 UTSW 14 74817085 missense probably damaging 1.00
R6740:Lrch1 UTSW 14 74811623 missense probably benign
R6871:Lrch1 UTSW 14 74811623 missense probably benign
R7051:Lrch1 UTSW 14 74785522 missense probably damaging 1.00
R7438:Lrch1 UTSW 14 74757037 missense possibly damaging 0.88
R7509:Lrch1 UTSW 14 74947608 missense probably benign 0.25
R8037:Lrch1 UTSW 14 74786354 missense probably damaging 1.00
RF002:Lrch1 UTSW 14 74947574 small deletion probably benign
RF009:Lrch1 UTSW 14 74947574 small deletion probably benign
RF018:Lrch1 UTSW 14 74947555 frame shift probably null
RF022:Lrch1 UTSW 14 74947574 small deletion probably benign
RF023:Lrch1 UTSW 14 74947566 frame shift probably null
RF037:Lrch1 UTSW 14 74947549 small deletion probably benign
RF039:Lrch1 UTSW 14 74947549 small deletion probably benign
RF043:Lrch1 UTSW 14 74947575 frame shift probably null
RF061:Lrch1 UTSW 14 74947555 frame shift probably null
RF061:Lrch1 UTSW 14 74947567 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGTCGTTCCCTTTCAGGACC -3'
(R):5'- CCTGGTGATGTACTGACAGAGTG -3'

Sequencing Primer
(F):5'- TGCTGACATCCGGGGAAG -3'
(R):5'- ATGTACTGACAGAGTGTTCTTTCC -3'
Posted On2015-01-23